ID: 1134419075

View in Genome Browser
Species Human (GRCh38)
Location 16:14069955-14069977
Sequence GAGTGAGGTTGAAACATGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134419067_1134419075 27 Left 1134419067 16:14069905-14069927 CCAGCAGGTGTGATTTTCCTTCT No data
Right 1134419075 16:14069955-14069977 GAGTGAGGTTGAAACATGCAAGG No data
1134419070_1134419075 1 Left 1134419070 16:14069931-14069953 CCCACTTCCTCCATCTGGTGAGT No data
Right 1134419075 16:14069955-14069977 GAGTGAGGTTGAAACATGCAAGG No data
1134419074_1134419075 -9 Left 1134419074 16:14069941-14069963 CCATCTGGTGAGTTGAGTGAGGT No data
Right 1134419075 16:14069955-14069977 GAGTGAGGTTGAAACATGCAAGG No data
1134419072_1134419075 -6 Left 1134419072 16:14069938-14069960 CCTCCATCTGGTGAGTTGAGTGA No data
Right 1134419075 16:14069955-14069977 GAGTGAGGTTGAAACATGCAAGG No data
1134419068_1134419075 10 Left 1134419068 16:14069922-14069944 CCTTCTTCACCCACTTCCTCCAT No data
Right 1134419075 16:14069955-14069977 GAGTGAGGTTGAAACATGCAAGG No data
1134419071_1134419075 0 Left 1134419071 16:14069932-14069954 CCACTTCCTCCATCTGGTGAGTT No data
Right 1134419075 16:14069955-14069977 GAGTGAGGTTGAAACATGCAAGG No data
1134419066_1134419075 28 Left 1134419066 16:14069904-14069926 CCCAGCAGGTGTGATTTTCCTTC No data
Right 1134419075 16:14069955-14069977 GAGTGAGGTTGAAACATGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134419075 Original CRISPR GAGTGAGGTTGAAACATGCA AGG Intergenic