ID: 1134419077

View in Genome Browser
Species Human (GRCh38)
Location 16:14069972-14069994
Sequence GCAAGGGCACCCACATGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134419072_1134419077 11 Left 1134419072 16:14069938-14069960 CCTCCATCTGGTGAGTTGAGTGA No data
Right 1134419077 16:14069972-14069994 GCAAGGGCACCCACATGCTCTGG No data
1134419068_1134419077 27 Left 1134419068 16:14069922-14069944 CCTTCTTCACCCACTTCCTCCAT No data
Right 1134419077 16:14069972-14069994 GCAAGGGCACCCACATGCTCTGG No data
1134419071_1134419077 17 Left 1134419071 16:14069932-14069954 CCACTTCCTCCATCTGGTGAGTT No data
Right 1134419077 16:14069972-14069994 GCAAGGGCACCCACATGCTCTGG No data
1134419070_1134419077 18 Left 1134419070 16:14069931-14069953 CCCACTTCCTCCATCTGGTGAGT No data
Right 1134419077 16:14069972-14069994 GCAAGGGCACCCACATGCTCTGG No data
1134419074_1134419077 8 Left 1134419074 16:14069941-14069963 CCATCTGGTGAGTTGAGTGAGGT No data
Right 1134419077 16:14069972-14069994 GCAAGGGCACCCACATGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134419077 Original CRISPR GCAAGGGCACCCACATGCTC TGG Intergenic