ID: 1134419116 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:14070208-14070230 |
Sequence | CCCAGCACTACCTTGTAGGT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1134419116_1134419125 | 25 | Left | 1134419116 | 16:14070208-14070230 | CCTACCTACAAGGTAGTGCTGGG | No data | ||
Right | 1134419125 | 16:14070256-14070278 | TCCTATTTCACAATGGAAACAGG | No data | ||||
1134419116_1134419124 | 18 | Left | 1134419116 | 16:14070208-14070230 | CCTACCTACAAGGTAGTGCTGGG | No data | ||
Right | 1134419124 | 16:14070249-14070271 | GTTCAAATCCTATTTCACAATGG | No data | ||||
1134419116_1134419120 | -4 | Left | 1134419116 | 16:14070208-14070230 | CCTACCTACAAGGTAGTGCTGGG | No data | ||
Right | 1134419120 | 16:14070227-14070249 | TGGGCTCCGGACTCAGACCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1134419116 | Original CRISPR | CCCAGCACTACCTTGTAGGT AGG (reversed) | Intergenic | ||