ID: 1134419118

View in Genome Browser
Species Human (GRCh38)
Location 16:14070212-14070234
Sequence GGAGCCCAGCACTACCTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134419118_1134419124 14 Left 1134419118 16:14070212-14070234 CCTACAAGGTAGTGCTGGGCTCC No data
Right 1134419124 16:14070249-14070271 GTTCAAATCCTATTTCACAATGG No data
1134419118_1134419120 -8 Left 1134419118 16:14070212-14070234 CCTACAAGGTAGTGCTGGGCTCC No data
Right 1134419120 16:14070227-14070249 TGGGCTCCGGACTCAGACCCAGG No data
1134419118_1134419125 21 Left 1134419118 16:14070212-14070234 CCTACAAGGTAGTGCTGGGCTCC No data
Right 1134419125 16:14070256-14070278 TCCTATTTCACAATGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134419118 Original CRISPR GGAGCCCAGCACTACCTTGT AGG (reversed) Intergenic