ID: 1134419121

View in Genome Browser
Species Human (GRCh38)
Location 16:14070233-14070255
Sequence TTTGAACCTGGGTCTGAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134419121_1134419124 -7 Left 1134419121 16:14070233-14070255 CCGGACTCAGACCCAGGTTCAAA No data
Right 1134419124 16:14070249-14070271 GTTCAAATCCTATTTCACAATGG No data
1134419121_1134419127 20 Left 1134419121 16:14070233-14070255 CCGGACTCAGACCCAGGTTCAAA No data
Right 1134419127 16:14070276-14070298 AGGCTACTTTCTCCACCTCCAGG No data
1134419121_1134419125 0 Left 1134419121 16:14070233-14070255 CCGGACTCAGACCCAGGTTCAAA No data
Right 1134419125 16:14070256-14070278 TCCTATTTCACAATGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134419121 Original CRISPR TTTGAACCTGGGTCTGAGTC CGG (reversed) Intergenic
No off target data available for this crispr