ID: 1134419124

View in Genome Browser
Species Human (GRCh38)
Location 16:14070249-14070271
Sequence GTTCAAATCCTATTTCACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134419116_1134419124 18 Left 1134419116 16:14070208-14070230 CCTACCTACAAGGTAGTGCTGGG No data
Right 1134419124 16:14070249-14070271 GTTCAAATCCTATTTCACAATGG No data
1134419121_1134419124 -7 Left 1134419121 16:14070233-14070255 CCGGACTCAGACCCAGGTTCAAA No data
Right 1134419124 16:14070249-14070271 GTTCAAATCCTATTTCACAATGG No data
1134419118_1134419124 14 Left 1134419118 16:14070212-14070234 CCTACAAGGTAGTGCTGGGCTCC No data
Right 1134419124 16:14070249-14070271 GTTCAAATCCTATTTCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134419124 Original CRISPR GTTCAAATCCTATTTCACAA TGG Intergenic
No off target data available for this crispr