ID: 1134419125 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:14070256-14070278 |
| Sequence | TCCTATTTCACAATGGAAAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1134419116_1134419125 | 25 | Left | 1134419116 | 16:14070208-14070230 | CCTACCTACAAGGTAGTGCTGGG | No data | ||
| Right | 1134419125 | 16:14070256-14070278 | TCCTATTTCACAATGGAAACAGG | No data | ||||
| 1134419118_1134419125 | 21 | Left | 1134419118 | 16:14070212-14070234 | CCTACAAGGTAGTGCTGGGCTCC | No data | ||
| Right | 1134419125 | 16:14070256-14070278 | TCCTATTTCACAATGGAAACAGG | No data | ||||
| 1134419121_1134419125 | 0 | Left | 1134419121 | 16:14070233-14070255 | CCGGACTCAGACCCAGGTTCAAA | No data | ||
| Right | 1134419125 | 16:14070256-14070278 | TCCTATTTCACAATGGAAACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1134419125 | Original CRISPR | TCCTATTTCACAATGGAAAC AGG | Intergenic | ||