ID: 1134419127

View in Genome Browser
Species Human (GRCh38)
Location 16:14070276-14070298
Sequence AGGCTACTTTCTCCACCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134419121_1134419127 20 Left 1134419121 16:14070233-14070255 CCGGACTCAGACCCAGGTTCAAA No data
Right 1134419127 16:14070276-14070298 AGGCTACTTTCTCCACCTCCAGG No data
1134419123_1134419127 8 Left 1134419123 16:14070245-14070267 CCAGGTTCAAATCCTATTTCACA No data
Right 1134419127 16:14070276-14070298 AGGCTACTTTCTCCACCTCCAGG No data
1134419122_1134419127 9 Left 1134419122 16:14070244-14070266 CCCAGGTTCAAATCCTATTTCAC No data
Right 1134419127 16:14070276-14070298 AGGCTACTTTCTCCACCTCCAGG No data
1134419126_1134419127 -4 Left 1134419126 16:14070257-14070279 CCTATTTCACAATGGAAACAGGC No data
Right 1134419127 16:14070276-14070298 AGGCTACTTTCTCCACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134419127 Original CRISPR AGGCTACTTTCTCCACCTCC AGG Intergenic