ID: 1134422592

View in Genome Browser
Species Human (GRCh38)
Location 16:14108170-14108192
Sequence CCTTCACAGCATCTAGCATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134422592_1134422600 10 Left 1134422592 16:14108170-14108192 CCCGATGCTAGATGCTGTGAAGG No data
Right 1134422600 16:14108203-14108225 GGGTGGGTTAAAGAACATTCAGG No data
1134422592_1134422598 -7 Left 1134422592 16:14108170-14108192 CCCGATGCTAGATGCTGTGAAGG No data
Right 1134422598 16:14108186-14108208 GTGAAGGAGTAGTATTGGGGTGG No data
1134422592_1134422597 -10 Left 1134422592 16:14108170-14108192 CCCGATGCTAGATGCTGTGAAGG No data
Right 1134422597 16:14108183-14108205 GCTGTGAAGGAGTAGTATTGGGG No data
1134422592_1134422601 16 Left 1134422592 16:14108170-14108192 CCCGATGCTAGATGCTGTGAAGG No data
Right 1134422601 16:14108209-14108231 GTTAAAGAACATTCAGGAAATGG No data
1134422592_1134422599 -6 Left 1134422592 16:14108170-14108192 CCCGATGCTAGATGCTGTGAAGG No data
Right 1134422599 16:14108187-14108209 TGAAGGAGTAGTATTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134422592 Original CRISPR CCTTCACAGCATCTAGCATC GGG (reversed) Intronic
No off target data available for this crispr