ID: 1134422597

View in Genome Browser
Species Human (GRCh38)
Location 16:14108183-14108205
Sequence GCTGTGAAGGAGTAGTATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134422589_1134422597 14 Left 1134422589 16:14108146-14108168 CCTGGATCTGAAAGAACTGCTGG No data
Right 1134422597 16:14108183-14108205 GCTGTGAAGGAGTAGTATTGGGG No data
1134422588_1134422597 15 Left 1134422588 16:14108145-14108167 CCCTGGATCTGAAAGAACTGCTG No data
Right 1134422597 16:14108183-14108205 GCTGTGAAGGAGTAGTATTGGGG No data
1134422592_1134422597 -10 Left 1134422592 16:14108170-14108192 CCCGATGCTAGATGCTGTGAAGG No data
Right 1134422597 16:14108183-14108205 GCTGTGAAGGAGTAGTATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134422597 Original CRISPR GCTGTGAAGGAGTAGTATTG GGG Intronic
No off target data available for this crispr