ID: 1134422599

View in Genome Browser
Species Human (GRCh38)
Location 16:14108187-14108209
Sequence TGAAGGAGTAGTATTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134422588_1134422599 19 Left 1134422588 16:14108145-14108167 CCCTGGATCTGAAAGAACTGCTG No data
Right 1134422599 16:14108187-14108209 TGAAGGAGTAGTATTGGGGTGGG No data
1134422592_1134422599 -6 Left 1134422592 16:14108170-14108192 CCCGATGCTAGATGCTGTGAAGG No data
Right 1134422599 16:14108187-14108209 TGAAGGAGTAGTATTGGGGTGGG No data
1134422589_1134422599 18 Left 1134422589 16:14108146-14108168 CCTGGATCTGAAAGAACTGCTGG No data
Right 1134422599 16:14108187-14108209 TGAAGGAGTAGTATTGGGGTGGG No data
1134422594_1134422599 -7 Left 1134422594 16:14108171-14108193 CCGATGCTAGATGCTGTGAAGGA No data
Right 1134422599 16:14108187-14108209 TGAAGGAGTAGTATTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134422599 Original CRISPR TGAAGGAGTAGTATTGGGGT GGG Intronic
No off target data available for this crispr