ID: 1134422601

View in Genome Browser
Species Human (GRCh38)
Location 16:14108209-14108231
Sequence GTTAAAGAACATTCAGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134422594_1134422601 15 Left 1134422594 16:14108171-14108193 CCGATGCTAGATGCTGTGAAGGA No data
Right 1134422601 16:14108209-14108231 GTTAAAGAACATTCAGGAAATGG No data
1134422592_1134422601 16 Left 1134422592 16:14108170-14108192 CCCGATGCTAGATGCTGTGAAGG No data
Right 1134422601 16:14108209-14108231 GTTAAAGAACATTCAGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134422601 Original CRISPR GTTAAAGAACATTCAGGAAA TGG Intronic
No off target data available for this crispr