ID: 1134433861

View in Genome Browser
Species Human (GRCh38)
Location 16:14236934-14236956
Sequence TCCAACTTGTCCACAAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134433861_1134433863 -3 Left 1134433861 16:14236934-14236956 CCAGGATTTGTGGACAAGTTGGA No data
Right 1134433863 16:14236954-14236976 GGATATGTGGTGTGAAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134433861 Original CRISPR TCCAACTTGTCCACAAATCC TGG (reversed) Intronic
No off target data available for this crispr