ID: 1134434201

View in Genome Browser
Species Human (GRCh38)
Location 16:14240413-14240435
Sequence GACTCAGGATCTGCAGTTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 404}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134434201 Original CRISPR GACTCAGGATCTGCAGTTGC AGG (reversed) Exonic
900946447 1:5833814-5833836 GACTCTGAATCTGCAGTGACAGG - Intergenic
901099584 1:6709104-6709126 GCCTCAGCCTCTCCAGTTGCTGG + Intergenic
902368045 1:15990146-15990168 GACTCAGGATCTGGGGGTCCCGG - Intergenic
903130267 1:21274557-21274579 GTCTCAGGGTCTGAAGTTTCAGG + Intronic
903539053 1:24086576-24086598 GGCTCAGGACCTGAAGCTGCAGG - Intronic
903956999 1:27032550-27032572 GACTCAGCCTCTGGAGTAGCTGG + Intergenic
904736649 1:32639508-32639530 GCCTCAGCCTCTTCAGTTGCTGG - Intronic
904911069 1:33934887-33934909 GCCTCAGCCTCTGGAGTTGCAGG - Intronic
905185323 1:36192165-36192187 GACTCAGCCTCTGGAGTAGCTGG + Intergenic
906421902 1:45675882-45675904 GTCTTAGGATCTGCAGTTTAAGG - Intronic
908106398 1:60847723-60847745 CACTCAGGATCTGTTGTTGAGGG - Intergenic
909232253 1:73105687-73105709 GTATGAGGATCTGCAGATGCTGG + Intergenic
909939001 1:81588961-81588983 GACTCAAAACCTGAAGTTGCAGG + Intronic
910887250 1:91977752-91977774 GACTCAGCCTCTGGAGTAGCTGG - Intronic
910970305 1:92849625-92849647 GCCTCAGCCTCTGGAGTTGCTGG + Intronic
911290310 1:96049447-96049469 TTATCAGGATCTGCAGTTGAGGG - Intergenic
911687592 1:100794675-100794697 GCCTCAGCATCTCCAGTCGCTGG - Intergenic
913539036 1:119801473-119801495 GACACAGGATCTTCTGTGGCTGG - Intronic
915132586 1:153705975-153705997 GACTCAGCCTCTGGAGTAGCTGG - Intergenic
916397352 1:164405570-164405592 GAGTCAGGACTTGGAGTTGCGGG - Intergenic
917216270 1:172681280-172681302 GACTGAGATTCTGCAGTTGGTGG + Intergenic
919651571 1:200154602-200154624 GCCTCAGCCTCTGCAGTAGCTGG - Intronic
919680330 1:200428088-200428110 GCCTCAGGCTCTACAGTAGCTGG - Intergenic
920410751 1:205758785-205758807 GCCTCAGCCTCTGCAGTAGCTGG - Intergenic
921728602 1:218552174-218552196 GACTCAGCCTCTGGAGTAGCTGG + Intergenic
922122777 1:222689323-222689345 GACTCAGCCTCTGGAGTAGCTGG - Intronic
923207348 1:231771917-231771939 GCCTCAGCATCTGGAGTAGCTGG + Intronic
924711881 1:246536111-246536133 GACTCAGTCTCTGGAGTAGCTGG + Intergenic
1063129509 10:3165725-3165747 GTCTCAGGATCTGCACTCGACGG + Intronic
1063235531 10:4111317-4111339 GCCTCAGCTTCTGAAGTTGCTGG - Intergenic
1063330478 10:5154035-5154057 GAAGTAGGATCTGTAGTTGCAGG - Intergenic
1063727986 10:8660562-8660584 GAATCAGGGTCTGCTGTTGCTGG + Intergenic
1064027540 10:11860499-11860521 GCCTCAGGATCCGGAGTAGCTGG - Intronic
1065286829 10:24194696-24194718 GCCTCAGCCTCTGCAGTAGCTGG + Intronic
1065289279 10:24214040-24214062 GCCTCAGAATCTGGAGTGGCTGG - Intronic
1066047377 10:31605054-31605076 GACTCCAAATCTGCAGGTGCTGG + Intergenic
1067080916 10:43211756-43211778 GGCCCAGGATCTGCAACTGCAGG - Intronic
1068983525 10:63086118-63086140 GCCTCAGGCTCTGGAGTAGCTGG - Intergenic
1069539643 10:69284137-69284159 GACTGATGCTCTGCAGTTGAGGG + Intronic
1069574231 10:69515580-69515602 GAGTCAGGATCTGAGGTTGCTGG - Intergenic
1069934940 10:71908819-71908841 GCCTCAGGCTCTTGAGTTGCTGG - Intergenic
1070198770 10:74183457-74183479 GACTCAGCTTCTGAAGTAGCTGG - Intronic
1070906477 10:80078125-80078147 GTCTCAGCCTCTGGAGTTGCTGG + Intergenic
1071573054 10:86708461-86708483 GACTCAGGACCTGTAGCTCCTGG + Intronic
1072167175 10:92825207-92825229 GCCTCAGGTTCTGGAGTAGCTGG - Intergenic
1072167987 10:92832390-92832412 GCCTCAGGCTCTGGAGTAGCTGG + Intergenic
1072410897 10:95201188-95201210 GACTCAGGAGGTGCATGTGCAGG + Intronic
1072589729 10:96818506-96818528 GACTCAGCCTCTGGAGTAGCTGG + Intergenic
1073413505 10:103362258-103362280 GCCTCAGCCTCTGCAGTAGCTGG + Intergenic
1075193777 10:120336209-120336231 GCCTCAGCCTCTGCAGTAGCTGG + Intergenic
1075999564 10:126904630-126904652 GACTCAGGATCTGCTGAAGTCGG - Intergenic
1076253436 10:129000831-129000853 GTCTGTGGATCTGCAGATGCTGG - Intergenic
1076298395 10:129405214-129405236 GACTCAGCCTCCTCAGTTGCTGG + Intergenic
1076796830 10:132802528-132802550 GCCTCAGCTTCTGCAGTAGCTGG + Intergenic
1077063888 11:630080-630102 GCCTCAGCCTCTGGAGTTGCTGG + Intergenic
1077625769 11:3769927-3769949 GCCTCAGCATCTGAAGTAGCTGG - Intronic
1079109821 11:17599073-17599095 GACTGAGAATCTGCAGCTGAGGG + Intronic
1080240640 11:30123279-30123301 GTCTCTGGATCTGCACTTGGGGG + Intergenic
1080621333 11:33989654-33989676 GAGTCAGGATCTGCAAGTGTAGG - Intergenic
1081043010 11:38235158-38235180 GCCTCAGGCTCTGGAGTAGCTGG - Intergenic
1081073675 11:38642165-38642187 GAGTGAGCATCAGCAGTTGCTGG - Intergenic
1083367882 11:62152439-62152461 GCCTCAGGATCACCAGGTGCAGG + Exonic
1083575689 11:63789408-63789430 GCCTCAGGCTCTGAAGTAGCTGG - Intergenic
1083950037 11:65949087-65949109 GACTCAGCCTCTGGAGTAGCTGG - Intronic
1084002422 11:66303959-66303981 GCCTCAGCCTCTGCAGTAGCTGG + Intergenic
1084176346 11:67424349-67424371 AACTCAGGGCCTGCAGGTGCTGG - Exonic
1084299178 11:68235123-68235145 GCCTCAGGCTCTGGAGTAGCTGG - Intergenic
1084499359 11:69525658-69525680 GCAGCAGGATCTGCAGGTGCAGG - Intergenic
1088121471 11:106375464-106375486 GCCTCAGCCTCTGCAGTAGCTGG - Intergenic
1090285043 11:125492851-125492873 GCCTCAGCCTCTCCAGTTGCTGG - Intronic
1092264665 12:6971386-6971408 GACTCAGCCTCTGGAGTAGCTGG + Intronic
1092365984 12:7877538-7877560 GTCTCAGCCTCTGGAGTTGCTGG + Intronic
1092651192 12:10637088-10637110 GGCTCAGGAAATGCAGTAGCAGG - Exonic
1093008470 12:14078299-14078321 GCCCCAAGATCTGCAGTTGGCGG + Intergenic
1093450597 12:19308945-19308967 GCCTCAGAATCTGGAGTAGCTGG - Intronic
1094184521 12:27626679-27626701 GCCTCAGCATCTCCAGTAGCTGG + Intronic
1094443127 12:30501208-30501230 GCCTCAGCCTCTGGAGTTGCTGG - Intergenic
1095054803 12:37586234-37586256 GCCTCAGCCTCTGCAGTAGCTGG + Intergenic
1096142697 12:49255678-49255700 GACTCAGCCTCTGGAGTAGCTGG + Intronic
1096831463 12:54317654-54317676 GCCTCAGCCTCTGCAGTAGCTGG - Intronic
1098292947 12:68976027-68976049 GTTTCAGGATGTGCAGCTGCTGG - Intergenic
1098890557 12:76006221-76006243 GACACAGGCTCTGGAGTTCCCGG - Intergenic
1099690467 12:85945262-85945284 GCCTCAGCATCTGGAGTGGCTGG - Intergenic
1100659181 12:96678364-96678386 GCCTCAGCCTCTTCAGTTGCTGG + Intronic
1101763515 12:107678200-107678222 GACTGAGGGAATGCAGTTGCTGG + Intergenic
1102491916 12:113294510-113294532 GACTCAGCCTCTTCAGTAGCTGG - Intronic
1102868621 12:116394447-116394469 AACTCAGCCTCTGCAGTAGCTGG - Intergenic
1102921551 12:116795291-116795313 GACTCAGCCTCTGGAGTAGCTGG - Intronic
1107460852 13:40600534-40600556 GACTCAGCATTTGCAGTAGTTGG - Intronic
1108284446 13:48892438-48892460 CAGTCAGGATCAGCAGATGCTGG - Intergenic
1109777119 13:67055689-67055711 TACTCAGGAGCTGAAGTGGCGGG + Intronic
1111013052 13:82337447-82337469 GACTCAGCATCTCGAGTAGCTGG + Intergenic
1111926637 13:94469958-94469980 GCCTCAGCCTCTGCAGTAGCTGG - Intronic
1113000029 13:105624630-105624652 CCTTCAGGATCTGCAGGTGCTGG + Intergenic
1113140690 13:107145982-107146004 GACAGAGGATCTGCAGCTTCTGG + Intergenic
1113968068 13:114165903-114165925 GACTGAGGAGCCGCAGTCGCTGG + Intergenic
1114155139 14:20093918-20093940 GACTTATGATCTGGAGTTGCTGG + Intergenic
1115309905 14:31968634-31968656 GAGACAGGATCTGCCTTTGCAGG + Intergenic
1115349542 14:32379031-32379053 GCCTCAGCCTCTGGAGTTGCTGG + Intronic
1116457944 14:45140922-45140944 GACTCAGCCTCTGGAGTAGCTGG - Intronic
1117016978 14:51528025-51528047 GACTCAGCCTCTGGAGTAGCTGG - Intronic
1118167199 14:63348278-63348300 GACTCAGGCTCTGCATTTTGGGG + Intergenic
1118233175 14:63973515-63973537 GCCTCAGCCTCTCCAGTTGCTGG - Intronic
1118897914 14:69962275-69962297 GACTCAGCCTCTGGAATTGCTGG + Intronic
1119285691 14:73452403-73452425 GCCTCAGCCTCTCCAGTTGCTGG - Intronic
1120259116 14:82160086-82160108 CAATCAGGATCTGCCTTTGCAGG + Intergenic
1120340039 14:83207982-83208004 GCCTCAGGCTCTGGAGTAGCTGG - Intergenic
1121262242 14:92574888-92574910 CACTCAGGATCTAGAGTTGAAGG + Intronic
1121336290 14:93079434-93079456 GACTCAGGAAGTGCAGGAGCTGG + Intronic
1122490019 14:102108648-102108670 GCCTCAGCCTCTGGAGTTGCTGG + Intronic
1122759296 14:104009878-104009900 GCCTCAGCCTCTGCAGTAGCTGG + Intronic
1123123375 14:105928409-105928431 AACGCAGGGTCTGCAGATGCAGG - Intronic
1202875830 14_GL000225v1_random:209820-209842 GCCTCAGCATCTGGAGTAGCTGG - Intergenic
1202878315 14_KI270722v1_random:31041-31063 GCCTCAGCATCTGGAGTAGCTGG - Intergenic
1123397261 15:19949127-19949149 CAGTCAGGACCTTCAGTTGCAGG - Intergenic
1123406020 15:20019913-20019935 AACCCAGGGTCTGCAGATGCAGG - Intergenic
1123515349 15:21026561-21026583 AACCCAGGGTCTGCAGATGCAGG - Intergenic
1124199082 15:27660954-27660976 GACTCAGGATCTGCAAAGGCTGG + Intergenic
1125811855 15:42548731-42548753 GACCCAGGACCCGCAGTAGCCGG + Exonic
1125857115 15:42961225-42961247 GCCTCAGCATCTTCAGTAGCTGG + Intronic
1126322675 15:47442438-47442460 GACTCAGGATCCCCAAATGCAGG - Intronic
1127469785 15:59280505-59280527 GACTCAGCCTCTGGAGTAGCTGG - Intronic
1127506059 15:59599035-59599057 GCCTCAGGCTCTGGAGTAGCTGG + Intronic
1130273256 15:82463306-82463328 GAACCTGGATCTGCAGGTGCAGG + Intergenic
1130357766 15:83150022-83150044 GATTCAGAATCTGGAGTTTCGGG + Intronic
1130465607 15:84190677-84190699 GAACCTGGATCTGCAGGTGCAGG + Intergenic
1130487084 15:84404143-84404165 GAACCTGGATCTGCAGGTGCAGG - Intergenic
1130498658 15:84482859-84482881 GAACCTGGATCTGCAGGTGCAGG - Intergenic
1130587897 15:85195272-85195294 GAACCTGGATCTGCAGGTGCAGG + Intergenic
1130773631 15:86952114-86952136 GCCTCAGCCTCTGCAGTAGCTGG - Intronic
1132081119 15:98866284-98866306 AAATCAGGATCTGCATTTACTGG - Intronic
1132666700 16:1084160-1084182 GCCTCAGCCTCAGCAGTTGCTGG - Intergenic
1132768829 16:1549544-1549566 GCCTCAGGCTCTTCAGTAGCTGG + Intronic
1132780635 16:1622874-1622896 GTCTCAGTATCTGGAGTAGCTGG + Intronic
1132941571 16:2511128-2511150 GCCTCAGCCTCTGCAGTAGCTGG + Intronic
1134318534 16:13141567-13141589 GACTCAGCCTCTCCAGTAGCTGG - Intronic
1134434201 16:14240413-14240435 GACTCAGGATCTGCAGTTGCAGG - Exonic
1135387951 16:22060756-22060778 GCCTCAGCCTCTGGAGTTGCTGG - Intronic
1135469878 16:22720974-22720996 GCCTCAGCCTCTGCAGTAGCTGG + Intergenic
1135561632 16:23481076-23481098 AACTCAGAATCTGAAGCTGCTGG + Intronic
1136506632 16:30708506-30708528 GCCTCAGGCTCTGGAGTAGCTGG + Intronic
1137222359 16:46469031-46469053 GCCTCAGCATCTGGAGTAGCTGG + Intergenic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1138690008 16:58758362-58758384 GCCTCAGCCTCTGCAGTAGCTGG + Intergenic
1138771171 16:59665431-59665453 GACTCAGCTTCTGAAGTAGCTGG - Intergenic
1138865396 16:60812408-60812430 GACTCAGGATCTGCTTCTGGAGG - Intergenic
1138878130 16:60978133-60978155 GACTAATGATCTGAAGTTCCTGG - Intergenic
1139532675 16:67550505-67550527 GCCTCAGCCTCTGGAGTTGCTGG + Intergenic
1139926064 16:70487480-70487502 GCCTCAGGCTCTGGAGTAGCTGG - Intronic
1139969171 16:70763099-70763121 GACTCAGGATGTGCAGGCCCAGG - Intronic
1140829681 16:78739694-78739716 GCCTCAGCCTCTGCAGTAGCTGG - Intronic
1141394247 16:83690834-83690856 GACTCAGCCTCTGGAGTAGCTGG + Intronic
1142856766 17:2735034-2735056 GCCTCAGGATCTCCAGGTGCAGG + Intergenic
1143154720 17:4829142-4829164 GCCTCAGGCTCTTGAGTTGCTGG - Intergenic
1143411661 17:6713081-6713103 CACTCAGGAGCTCCAGGTGCCGG - Intronic
1144955997 17:19019202-19019224 GAGTCAGGAGCTGCACCTGCAGG + Intronic
1145017484 17:19408648-19408670 GACTCAGCCTCTCCAGTAGCTGG - Intergenic
1145068943 17:19786597-19786619 GACTCAGGCTCTTGAGTAGCTGG - Intronic
1145126310 17:20302805-20302827 GCCTCAGGCTCTGGAGTAGCTGG - Intronic
1145187010 17:20803507-20803529 GACTCAGACTCTGGAGTAGCTGG - Intergenic
1145832368 17:27927033-27927055 GCCTCAGCCTCTGGAGTTGCTGG - Intergenic
1145890055 17:28407856-28407878 GACTCAGGATGGGTAGGTGCTGG + Intergenic
1146118394 17:30164681-30164703 GCCTCAGCATCTGGAGTAGCTGG - Intronic
1146601213 17:34218284-34218306 GCCTCAGCATCTGGAGTAGCTGG - Intergenic
1146660494 17:34662405-34662427 GACTCAGGATCTTCTGCTGGGGG + Intergenic
1146813578 17:35923962-35923984 GCCTCAGGATCCCAAGTTGCTGG - Intronic
1147618663 17:41846998-41847020 GCCTCAGCATCTGGAGTAGCTGG - Intronic
1148472049 17:47900660-47900682 GCCTCAGCCTCTGCAGTAGCTGG - Intronic
1148663836 17:49360650-49360672 GATTGAGGAGCTGCTGTTGCTGG - Intronic
1148837423 17:50472784-50472806 GACTCAGATTTTGCAGCTGCTGG - Intronic
1149888614 17:60366090-60366112 GACTCAGCCTCTCCAGTAGCTGG + Intronic
1150646931 17:66984637-66984659 GTCTCAGAATCTGCAGATACAGG - Intronic
1150785278 17:68157706-68157728 GCCTCAGGATCTCAAGATGCTGG - Intergenic
1151313558 17:73308921-73308943 GCCTCAGCCTCTGCAGTAGCTGG - Intronic
1151453168 17:74211667-74211689 GACTCAGTCCCTGCAGTTGCTGG - Intergenic
1152204974 17:78969815-78969837 GACGCAGGATCTGGAGGTGGGGG + Intergenic
1152350862 17:79783522-79783544 GCCTCAGCCTCTGCAGTAGCTGG + Intronic
1153205782 18:2699107-2699129 GAATCAGGATCTCTGGTTGCAGG - Intronic
1153933987 18:9904413-9904435 GACTCAGCTTCTCCAGTAGCTGG + Intergenic
1154215770 18:12415041-12415063 ATCTCAGGCTCTGCAGTAGCTGG + Intronic
1156319470 18:36005184-36005206 GCCTCAGGCTCTGGAGTAGCTGG - Intronic
1156456593 18:37298210-37298232 GCCCAAGGATCTGCAGATGCTGG + Intronic
1156921534 18:42528450-42528472 GCCTCAGCCTCTGCAGTAGCTGG - Intergenic
1157180843 18:45496666-45496688 GCCTCAGCCTCTGCAGTAGCTGG - Intronic
1157273823 18:46296071-46296093 GCCTCAGCTTCTGGAGTTGCTGG + Intergenic
1157869271 18:51214926-51214948 AGCTCAGGATCTGCAGTTTAGGG - Intronic
1158366841 18:56745896-56745918 AACTTAGGGTCTGCAGTTGTTGG - Intronic
1161711429 19:5850821-5850843 GCCTCAGGCTCTGGAGTAGCTGG - Intronic
1161733187 19:5974823-5974845 GACTGAGCATCTGCGGTTTCAGG + Intronic
1162388744 19:10377014-10377036 GCCTCAGGCTCTCAAGTTGCTGG + Intronic
1163099062 19:15082571-15082593 CACTGAGGGTCTGCAGCTGCAGG + Intergenic
1163394764 19:17053348-17053370 GACACAGGTCCCGCAGTTGCAGG - Intronic
1163917287 19:20252183-20252205 GTCTCAGCCTCTGGAGTTGCTGG - Intergenic
1164084353 19:21887917-21887939 TAATCAGGCTCTGCAATTGCCGG - Intergenic
1164230055 19:23279403-23279425 GCCTCAGCCTCTGCAGTAGCTGG + Intergenic
1164736260 19:30543647-30543669 GACTCAGCATCTGCCTGTGCCGG + Intronic
1165139072 19:33688352-33688374 TACTCTGGGTCTGCAGTGGCTGG + Intronic
1165564923 19:36716938-36716960 GACTCAGCCTCTGGAGTAGCTGG + Intronic
1166286442 19:41832815-41832837 GCCTCAGGCTCTGGAGTAGCTGG + Intergenic
1166664546 19:44671234-44671256 GCCTCAGCCTCTCCAGTTGCTGG + Intronic
1167045198 19:47045537-47045559 GACCCAGCCTCTGCAGGTGCGGG - Exonic
1167126254 19:47551152-47551174 GCCTCAGCCTCTGCAGTAGCTGG + Intronic
1167763436 19:51463393-51463415 GCCTCAGCATCTGGAGTAGCTGG - Intergenic
1167911250 19:52703704-52703726 GCCTCAGCATCTGGAGTAGCTGG + Exonic
1168004984 19:53479388-53479410 GATCCAGGTTCTGCAGCTGCAGG + Intronic
1168407486 19:56118496-56118518 GACACAGGTTCTGAAGCTGCTGG + Intronic
1168663897 19:58187838-58187860 GCCTCAGCCTCTGCAGTAGCTGG + Intronic
1202653937 1_KI270708v1_random:90-112 GCCTCAGCATCTGGAGTAGCTGG - Intergenic
1202672361 1_KI270710v1_random:1889-1911 GCCTCAGCATCTGGAGTAGCTGG + Intergenic
925178297 2:1800163-1800185 CACTCAGGAGCTGCTGTTTCTGG - Intronic
927188287 2:20497982-20498004 GACTCAAGAGCTGCTGTGGCAGG - Intergenic
927669595 2:25058060-25058082 GCCTCAGCATCTGGAGTAGCTGG - Intronic
927885250 2:26714303-26714325 AACTCAGGAGCTGCAACTGCAGG + Intronic
929117822 2:38459043-38459065 GTCTCAGCCTCTGCAGTAGCTGG + Intergenic
929659561 2:43770221-43770243 GCCTCAGCCTCTGCAGTAGCTGG + Intergenic
931726931 2:65120339-65120361 GCCTCAGCCTCTGAAGTTGCTGG - Intronic
932557052 2:72833739-72833761 GCCTCAGCATCTCCAGTAGCTGG + Intergenic
932578881 2:72980578-72980600 GACTCAGGATCGGGAATTTCTGG + Intronic
933440742 2:82310639-82310661 GACTCAGCTTCTGGAGTAGCTGG - Intergenic
933818782 2:86090829-86090851 GCCTCAGCATCTGGAGTAGCTGG - Intronic
935014196 2:99164432-99164454 GCCTCAGGTTCTGGAGTAGCCGG + Intronic
935441289 2:103099213-103099235 GCCTCAGCCTCTGCAGTAGCTGG - Intergenic
936634366 2:114238455-114238477 GACTCAGAATCTGGATTTTCTGG + Intergenic
937183734 2:120019184-120019206 GACTTAGAATCTCCAGCTGCAGG - Exonic
938289233 2:130140667-130140689 GTCTCGGGATGTGCAGATGCAGG + Intronic
938842750 2:135178745-135178767 GCCTCAGGATCTCAAGTAGCTGG - Intronic
939162285 2:138604807-138604829 ACCTCAGGCTCTGGAGTTGCTGG - Intergenic
939497707 2:142943758-142943780 GACTGAGGGTCTGCAGCTGTGGG - Intronic
939880387 2:147624349-147624371 GCCTCAGCATCTGGAGTAGCTGG + Intergenic
940048003 2:149430212-149430234 GCCTCAGCATCTGGAGTAGCTGG + Intronic
940299460 2:152161935-152161957 GCCTCAGCCTCTGGAGTTGCTGG + Intronic
942051668 2:172146353-172146375 GACTCAGGTTCTGTTGTTGGTGG + Intergenic
942738810 2:179148943-179148965 GCCTCAGCATCTCCAGTAGCTGG - Intronic
943062208 2:183050851-183050873 GAATCAGGATCTGCATCTGCAGG + Intergenic
943743722 2:191439068-191439090 GCCTCAGCCTCTGGAGTTGCTGG - Intergenic
946020548 2:216636960-216636982 GGCTCTGCATCTGCAGTTGCCGG + Intronic
946280857 2:218664510-218664532 GACTCAGGTTCCGCAGGGGCAGG + Exonic
947046663 2:225994929-225994951 GACTCAGTGTCTGCAGTAGATGG + Intergenic
947665323 2:231901688-231901710 GCCTCTGGATATGCAGTTGGAGG + Intergenic
948455717 2:238103776-238103798 CCCTCAGGCTCTGCAGGTGCAGG + Intronic
1168815380 20:733295-733317 GCCTCAGGCTCTGGAGTAGCTGG + Intergenic
1173202150 20:40962061-40962083 GAGTCAGGATCTGCTGTTCCTGG - Intergenic
1173580535 20:44143696-44143718 GTCTCAGGCTCTGCTTTTGCAGG + Intronic
1175948262 20:62568735-62568757 GGCTGAGGATCTGCAGATCCTGG + Intronic
1175969788 20:62679087-62679109 GCCTCAGCCTCTGCAGTAGCTGG - Intronic
1176417712 21:6487841-6487863 GTCTCAGCCTCTGGAGTTGCTGG + Intergenic
1178529538 21:33363907-33363929 GCCTCAGCATCTGGAGTAGCTGG + Intergenic
1179347115 21:40568933-40568955 GCCTCAGCATCTCCAGGTGCTGG + Intronic
1179548262 21:42126407-42126429 GGCTCAGGATCTTCAGGTGGTGG - Exonic
1179693206 21:43096172-43096194 GTCTCAGCCTCTGGAGTTGCTGG + Intronic
1179771015 21:43616814-43616836 GCCTCAGCATCTGGAGTAGCTGG - Intronic
1180389566 22:12214331-12214353 GCCTCAGCATCTGGAGTAGCTGG + Intergenic
1180416372 22:12720151-12720173 GCCTCAGCATCTGGAGTAGCTGG - Intergenic
1180760148 22:18196107-18196129 GATTCAAGAATTGCAGTTGCGGG - Intergenic
1180770459 22:18380406-18380428 GATTCAAGAATTGCAGTTGCGGG - Intergenic
1180775520 22:18428589-18428611 GATTCAAGAATTGCAGTTGCGGG + Intergenic
1180808593 22:18739644-18739666 GATTCAAGAATTGCAGTTGCGGG + Intergenic
1180828401 22:18883363-18883385 GATTCAAGAATTGCAGTTGCGGG - Intergenic
1181071519 22:20344608-20344630 GATTCAAGAATTGCAGTTGCGGG + Intergenic
1181194589 22:21173558-21173580 GATTCAAGAATTGCAGTTGCGGG + Intergenic
1181214854 22:21319220-21319242 GATTCAAGAATTGCAGTTGCGGG - Intergenic
1181685302 22:24523829-24523851 CTCTCAGGAACTGCTGTTGCGGG + Intronic
1182017991 22:27056735-27056757 GGCCCAGGACCTGCATTTGCAGG - Intergenic
1182219921 22:28750132-28750154 GCCTCAGCCTCTGAAGTTGCTGG - Intronic
1182593348 22:31399254-31399276 GACCCAGGACCCGCAGATGCTGG + Intergenic
1182995216 22:34805975-34805997 GAGCCAGGATCTGGAGATGCAGG - Intergenic
1183499582 22:38170474-38170496 GACTCAGGAGCAGCAGTGTCTGG + Intronic
1183904848 22:41032864-41032886 GCCTAAGGATCTGCATTTGATGG - Intergenic
1184035079 22:41914428-41914450 GGCTCCGGAGCTGCAGTTGAAGG + Exonic
1184263638 22:43334105-43334127 AGCTCAGGACCTGCAGATGCAGG + Intronic
1184725104 22:46340001-46340023 GTCTCAGGAAGTGCTGTTGCTGG + Intronic
1185381482 22:50510034-50510056 GCCTCAGCCTCTGCAGTAGCTGG + Intronic
1203232294 22_KI270731v1_random:121578-121600 GATTCAAGAATTGCAGTTGCGGG - Intergenic
1203278498 22_KI270734v1_random:109352-109374 GATTCAAGAATTGCAGTTGCGGG - Intergenic
949259423 3:2088025-2088047 GCCTCAGGCTCTTGAGTTGCTGG + Intergenic
954189633 3:48948381-48948403 GACTCAGCCTCTGAAGTAGCTGG + Intronic
954425245 3:50439713-50439735 GCCACAGGGTCTGCAGTTGGAGG + Intronic
955197941 3:56822736-56822758 GACTCAGCCTCTGGAGTAGCTGG - Intronic
956207318 3:66768875-66768897 GACTCAGGATCCTCAGCTGTAGG + Intergenic
958456665 3:94340397-94340419 GACTCAGGGTCTGCAGAAGCAGG + Intergenic
959198473 3:103215373-103215395 GAATCAGGATCCGCATCTGCAGG - Intergenic
959707555 3:109352409-109352431 GCCTCAGGCTCTGGAGTAGCTGG + Intergenic
960560041 3:119073617-119073639 GGCGCACGCTCTGCAGTTGCTGG + Intronic
961263530 3:125621760-125621782 GTCTCAGCCTCTGCAGTAGCTGG - Intergenic
961596309 3:128020537-128020559 GCCTCAGCCTCTGCAGTAGCTGG - Intergenic
961826379 3:129601398-129601420 GACCCAGGCTCTGGAGTTGTGGG + Intronic
962872628 3:139511198-139511220 GCCTCAGGCTCTGAAGTAGCTGG - Intergenic
963331215 3:143918387-143918409 TACTGAGGCTCTGCAATTGCTGG + Intergenic
967515926 3:190368397-190368419 GACTCAGGATCTCAAGCTGTTGG - Intronic
969036834 4:4260960-4260982 GCCTCAGCCTCTGGAGTTGCTGG + Intergenic
970616536 4:17773326-17773348 GACTCAGCATTTGCTCTTGCAGG + Intronic
971527824 4:27643762-27643784 GCCTCAGCTTCTGCAGTAGCTGG + Intergenic
972462324 4:39316113-39316135 GCCTCAGCCTCTGGAGTTGCTGG - Intronic
972547932 4:40099355-40099377 GCCTCAGGCTCTGAAGTAGCTGG + Intronic
973826499 4:54712359-54712381 CACCCACGATCTGCTGTTGCTGG - Intronic
974162343 4:58156212-58156234 GACTCAGCCTCTGAAGTAGCTGG + Intergenic
974609737 4:64200620-64200642 GACTCAGCCTCTGGAGTAGCTGG - Intergenic
976206077 4:82624719-82624741 GCCTCAGGCTCTGGAGTAGCTGG - Intergenic
980050323 4:128033137-128033159 GCCTCAGCCTCTGCAGTAGCTGG - Intronic
980050369 4:128033648-128033670 GCCTCAGCCTCTGCAGTAGCTGG + Intronic
980082282 4:128356863-128356885 GTCTCAGGGTCTGCTTTTGCAGG + Intergenic
981574870 4:146193959-146193981 GAATCAGCATCTGCTGTGGCAGG + Intronic
981747511 4:148065894-148065916 GCCTCAGCCTCTGCAGTAGCTGG - Intronic
983503796 4:168530452-168530474 GAGGCAGGAACTTCAGTTGCAGG - Intronic
984518938 4:180776838-180776860 GTCTCATGATCTGCAGTTTCAGG + Intergenic
984556342 4:181218571-181218593 GCCTCAGCCTCTGCAGTAGCTGG - Intergenic
986204659 5:5612229-5612251 GCCACAGGATCTGGAGTTGCAGG - Intergenic
987125765 5:14811049-14811071 GGATCATGATCTGCACTTGCAGG - Intronic
987187947 5:15444445-15444467 GACTAAGGATGTTTAGTTGCTGG + Intergenic
987922649 5:24303780-24303802 GCCTCAGCATCTGGAGTAGCTGG - Intergenic
988268014 5:28976659-28976681 GACTCAGCCTCTGGAGTAGCTGG - Intergenic
989058063 5:37383692-37383714 GCCTCAGGCTCTGGAGTAGCTGG + Intronic
989213402 5:38879736-38879758 GCCTCAGCATCTTGAGTTGCTGG + Intronic
990169058 5:53027705-53027727 GATTCAGAATCTGAAGTTCCAGG - Intronic
990524774 5:56614159-56614181 GACCCAGGATGTCCTGTTGCAGG - Intergenic
990688974 5:58340797-58340819 GACTCAGGAGATGCAGGTACAGG + Intergenic
993097053 5:83491744-83491766 GTATAAGTATCTGCAGTTGCTGG - Intronic
997080302 5:130731056-130731078 GACTCTGGATCTGGAGTTGGGGG - Intergenic
997506065 5:134418250-134418272 GCCTCAGGCTCTGGAGTAGCTGG + Intergenic
999299893 5:150484905-150484927 GACTCAGGATCTCCAGGGCCGGG + Intergenic
999304273 5:150509625-150509647 GCCTCAGCCTCTGGAGTTGCTGG + Intronic
999859640 5:155632231-155632253 GACTCAGGATCTGAAGATTTAGG + Intergenic
1000463969 5:161552641-161552663 GCCTCAGGCTCTGGAGTAGCTGG - Intronic
1000729064 5:164808707-164808729 GCCTCAGCCTCTCCAGTTGCTGG + Intergenic
1000976925 5:167775082-167775104 GACTCAGCCTCTCAAGTTGCTGG + Intronic
1001598781 5:172915520-172915542 GACTTAGGATCTGAAGCTCCTGG - Intronic
1001864462 5:175091448-175091470 GACTCAGCATGTGAACTTGCGGG - Intergenic
1001957820 5:175860306-175860328 GCTTCAGCATCTGCAGTAGCTGG - Intronic
1002811237 6:631421-631443 GCCTCAGCCTCTGCAGTAGCCGG - Intronic
1003546823 6:7066174-7066196 GCCTCAGCCTCTGCAGTAGCTGG - Intergenic
1005008516 6:21313585-21313607 GTGTCAGGATCTGCAGTTGCTGG + Intergenic
1005454951 6:26010636-26010658 GACTGAGGTTATGCAGCTGCAGG - Intergenic
1005617021 6:27583196-27583218 GCCTCAGGCTCTGGAGTAGCTGG - Intergenic
1007453831 6:41960951-41960973 AACTCAGGATCTCCACTTTCAGG + Intronic
1008945067 6:57088517-57088539 AACTCAGTAACTGTAGTTGCAGG - Intronic
1009419765 6:63452361-63452383 GCCTCAGCCTCTGGAGTTGCTGG + Intergenic
1010689134 6:78888630-78888652 GCCTCAGCCTCTGGAGTTGCTGG + Intronic
1011281979 6:85686738-85686760 GCCTCAGCCTCTGGAGTTGCTGG - Intergenic
1012570025 6:100712870-100712892 GCCTCAGGCTCTGCAGCAGCTGG + Intronic
1012962697 6:105639125-105639147 GTCTAAGGGTCTGCAGATGCAGG - Intergenic
1013110669 6:107062400-107062422 GACTCAGCCTCCTCAGTTGCTGG + Intergenic
1013813918 6:114075070-114075092 GCATCAGGAACTGCAGATGCAGG + Intronic
1015893250 6:137990155-137990177 AACTCAGCCTCTTCAGTTGCTGG - Intergenic
1015964276 6:138682786-138682808 GACTCAGAATCTCCAGGGGCGGG + Intronic
1016297483 6:142589030-142589052 GCCTCAGTCTCTGCAGTAGCTGG - Intergenic
1016711489 6:147177845-147177867 GCCTCAGCATCTGAAGTAGCTGG + Intergenic
1016934400 6:149438667-149438689 GCCTCAGCCTCTGCAGTAGCTGG + Intergenic
1017452997 6:154571935-154571957 GCCTCAGCATCTTCAGTAGCTGG + Intergenic
1018175166 6:161172270-161172292 GACCCAGAATCTGCAGATCCTGG - Intronic
1018520865 6:164649901-164649923 GCCTCAGCATCTGAAGTAGCTGG + Intergenic
1019401976 7:860262-860284 TCCGCAGGATCTGCAGCTGCAGG - Exonic
1020100406 7:5391165-5391187 GACCCAGCATCTTCAGCTGCTGG + Intronic
1020905429 7:14058318-14058340 CATTCAGGCTATGCAGTTGCAGG - Intergenic
1021298384 7:18938478-18938500 GACTCAGGCTCCGGAGTAGCTGG - Intronic
1021572420 7:22079900-22079922 GCCTCAGCCTCTGCAGTAGCTGG + Intergenic
1021711428 7:23419736-23419758 GCCTCAGCATCTGGAGTAGCTGG - Intronic
1022325317 7:29325665-29325687 AACTCAGCCTATGCAGTTGCAGG + Intronic
1022671651 7:32461610-32461632 TTCTCAGGATCTGCTTTTGCGGG - Intergenic
1024300796 7:47885943-47885965 GCATCAGGATCTGCAGTGCCAGG + Exonic
1026706834 7:72701376-72701398 GACTCAGCATCCTCAGTAGCTGG + Intronic
1029245074 7:99193467-99193489 GTCTGGGGATCTGCAGGTGCTGG + Intronic
1029709360 7:102291187-102291209 GACTGAGGGTCTGCAGACGCCGG + Intronic
1030037990 7:105424423-105424445 GCCTCAGCATCTGAAGTAGCTGG + Intergenic
1030289567 7:107858776-107858798 GCCTCAGGCTCTGGAGTAGCTGG + Intergenic
1032798721 7:135301066-135301088 GCCTCTGGAGCTCCAGTTGCTGG + Intergenic
1034268983 7:149794528-149794550 GGATTAGGAACTGCAGTTGCTGG + Intergenic
1036136506 8:6166611-6166633 GACACAGGACCTGCAGTGACTGG + Intergenic
1036685416 8:10906110-10906132 GAATCTGGATCTGCATGTGCTGG + Intronic
1037125532 8:15343514-15343536 GCCTCAGCATCTGGAGTAGCTGG - Intergenic
1037887312 8:22601822-22601844 GCCTCTGGATCCGCAGCTGCAGG - Exonic
1038667041 8:29546929-29546951 GCCTCAGGATCAGCAGCAGCAGG + Intergenic
1039582329 8:38677121-38677143 GCCTCAGCCTCTGCAGTCGCTGG + Intergenic
1039787476 8:40846665-40846687 GACTCAGGAACTGCAGGAGCAGG + Intronic
1040081420 8:43289760-43289782 GCCTCAGCCTCTGCAGTAGCTGG - Intergenic
1042291849 8:67176954-67176976 GACTCAGGCTCCGGAGTAGCTGG - Intronic
1043847047 8:85176101-85176123 GCCTCAGGCTCTGGAGTAGCTGG + Intergenic
1044970130 8:97611342-97611364 GCCTCAGCTTCTGCAGTAGCTGG - Intergenic
1045061864 8:98418022-98418044 GCCTCAGGTTCTCCAGTAGCTGG + Intronic
1046107015 8:109678553-109678575 GACTCAGCCTCTGGAGTAGCTGG + Intronic
1046295532 8:112215047-112215069 GCCTCAGACTCTGGAGTTGCTGG + Intergenic
1047053751 8:121141576-121141598 GACTCAGCCTCTGGAGTAGCTGG - Intergenic
1047492764 8:125388000-125388022 GCCTCAGCCTCTGCAGTAGCTGG - Intergenic
1047938657 8:129806529-129806551 GCCTCAGGATCCACAGTAGCAGG + Intergenic
1049014915 8:139913566-139913588 GAGGCAGGGTCTGCAGTTTCAGG - Intronic
1049053598 8:140217900-140217922 GCCTCAGCCTCTGCAGTAGCTGG - Intronic
1050436285 9:5613921-5613943 GCCTCAGCCTCTGCAGTAGCTGG - Intergenic
1057334156 9:94142771-94142793 GCCTCAGCCTCTGCAGTAGCTGG + Intergenic
1057567859 9:96180839-96180861 AATTCAGGACCTGCGGTTGCTGG + Intergenic
1057735326 9:97653233-97653255 GCCTCAGGCTCTCAAGTTGCTGG + Intronic
1058984161 9:110196255-110196277 GCCTCAGCCTCTGAAGTTGCTGG - Intronic
1061401272 9:130369721-130369743 GACCCTGGTTCTGCAGCTGCAGG - Intronic
1061663344 9:132145644-132145666 GCCTCAGCATCTGGAGTAGCTGG - Intergenic
1061683273 9:132254856-132254878 GCCTCAGGCTCTGGAGTAGCTGG - Intergenic
1061760617 9:132848659-132848681 GGCTCACCATCTGCAGTTGAAGG - Intronic
1062422988 9:136492986-136493008 TTCCCAGGGTCTGCAGTTGCAGG + Intergenic
1062535678 9:137020184-137020206 GACACAGGCTCTGCAGGTGGGGG - Intronic
1062545147 9:137059149-137059171 GCCTCAGCCTCTGCAGTAGCTGG + Intergenic
1186662203 X:11680098-11680120 GCCTCAGCCTCTGCAGTAGCTGG + Intergenic
1187686351 X:21819459-21819481 GACTCAGCATCTGGACTAGCTGG + Intergenic
1187794716 X:22990845-22990867 GCCTCAGCCTCTGGAGTTGCTGG + Intergenic
1188113673 X:26219609-26219631 GAGTCAGCAGCTGCAGCTGCTGG + Intergenic
1188250408 X:27886719-27886741 GCCTCAGCCTCTGCAGTAGCTGG - Intergenic
1188959977 X:36479329-36479351 GACTCAGGTTCTGCCTTTGGGGG - Intergenic
1189369171 X:40414216-40414238 GACTCAGGATCTGCTTCTGGGGG - Intergenic
1192576740 X:72248760-72248782 GACTCAGCCTCTGGAGTAGCTGG - Intronic
1194304277 X:92223098-92223120 AACTCAGCCTCTGTAGTTGCTGG + Intronic
1195330241 X:103791441-103791463 GCCTGAGGAGCAGCAGTTGCTGG + Exonic
1195941348 X:110170333-110170355 GACTGTGAGTCTGCAGTTGCAGG + Intronic
1196598688 X:117575549-117575571 GCCTCAGGCTCTGGAGTAGCTGG + Intergenic
1196690393 X:118552761-118552783 GACTCAGCCTCTTAAGTTGCTGG - Intronic
1197247210 X:124178475-124178497 GTCTCAGCCTCTGCAGTAGCTGG - Intronic
1200247436 X:154533632-154533654 GACACAGCATCTGCAGTAGGTGG + Exonic
1201170132 Y:11251573-11251595 GCCTCAGCATCTGGAGTAGCTGG + Intergenic
1201684376 Y:16684115-16684137 CACTCAGGATCCTCAGCTGCAGG - Intergenic
1202189264 Y:22224069-22224091 GACCCAGGATATGGAGATGCAGG - Intergenic
1202250804 Y:22870822-22870844 GACTCAGCTTCTCCAGTAGCTGG + Intergenic
1202369626 Y:24188047-24188069 GAACCTGGATCTGCAGGTGCAGG - Intergenic
1202403793 Y:24504571-24504593 GACTCAGCTTCTCCAGTAGCTGG + Intergenic
1202466986 Y:25165511-25165533 GACTCAGCTTCTCCAGTAGCTGG - Intergenic
1202501159 Y:25482070-25482092 GAACCTGGATCTGCAGGTGCAGG + Intergenic