ID: 1134438960

View in Genome Browser
Species Human (GRCh38)
Location 16:14286156-14286178
Sequence GCCGGGGCCGGCCAAATTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134438960_1134438966 7 Left 1134438960 16:14286156-14286178 CCGCAAATTTGGCCGGCCCCGGC No data
Right 1134438966 16:14286186-14286208 TCCCTACACACAGCTACCCCTGG No data
1134438960_1134438968 8 Left 1134438960 16:14286156-14286178 CCGCAAATTTGGCCGGCCCCGGC No data
Right 1134438968 16:14286187-14286209 CCCTACACACAGCTACCCCTGGG No data
1134438960_1134438970 9 Left 1134438960 16:14286156-14286178 CCGCAAATTTGGCCGGCCCCGGC No data
Right 1134438970 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
1134438960_1134438973 24 Left 1134438960 16:14286156-14286178 CCGCAAATTTGGCCGGCCCCGGC No data
Right 1134438973 16:14286203-14286225 CCCTGGGGCGCTTCATCCCCTGG No data
1134438960_1134438975 25 Left 1134438960 16:14286156-14286178 CCGCAAATTTGGCCGGCCCCGGC No data
Right 1134438975 16:14286204-14286226 CCTGGGGCGCTTCATCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134438960 Original CRISPR GCCGGGGCCGGCCAAATTTG CGG (reversed) Intergenic
No off target data available for this crispr