ID: 1134438962

View in Genome Browser
Species Human (GRCh38)
Location 16:14286168-14286190
Sequence AGGGAGCCGATCGCCGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134438962_1134438975 13 Left 1134438962 16:14286168-14286190 CCGGCCCCGGCGATCGGCTCCCT No data
Right 1134438975 16:14286204-14286226 CCTGGGGCGCTTCATCCCCTGGG No data
1134438962_1134438977 25 Left 1134438962 16:14286168-14286190 CCGGCCCCGGCGATCGGCTCCCT No data
Right 1134438977 16:14286216-14286238 CATCCCCTGGGAGAAGATGGAGG No data
1134438962_1134438976 22 Left 1134438962 16:14286168-14286190 CCGGCCCCGGCGATCGGCTCCCT No data
Right 1134438976 16:14286213-14286235 CTTCATCCCCTGGGAGAAGATGG No data
1134438962_1134438970 -3 Left 1134438962 16:14286168-14286190 CCGGCCCCGGCGATCGGCTCCCT No data
Right 1134438970 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
1134438962_1134438978 26 Left 1134438962 16:14286168-14286190 CCGGCCCCGGCGATCGGCTCCCT No data
Right 1134438978 16:14286217-14286239 ATCCCCTGGGAGAAGATGGAGGG No data
1134438962_1134438968 -4 Left 1134438962 16:14286168-14286190 CCGGCCCCGGCGATCGGCTCCCT No data
Right 1134438968 16:14286187-14286209 CCCTACACACAGCTACCCCTGGG No data
1134438962_1134438973 12 Left 1134438962 16:14286168-14286190 CCGGCCCCGGCGATCGGCTCCCT No data
Right 1134438973 16:14286203-14286225 CCCTGGGGCGCTTCATCCCCTGG No data
1134438962_1134438966 -5 Left 1134438962 16:14286168-14286190 CCGGCCCCGGCGATCGGCTCCCT No data
Right 1134438966 16:14286186-14286208 TCCCTACACACAGCTACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134438962 Original CRISPR AGGGAGCCGATCGCCGGGGC CGG (reversed) Intergenic
No off target data available for this crispr