ID: 1134438963

View in Genome Browser
Species Human (GRCh38)
Location 16:14286172-14286194
Sequence GTGTAGGGAGCCGATCGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134438963_1134438970 -7 Left 1134438963 16:14286172-14286194 CCCCGGCGATCGGCTCCCTACAC No data
Right 1134438970 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
1134438963_1134438968 -8 Left 1134438963 16:14286172-14286194 CCCCGGCGATCGGCTCCCTACAC No data
Right 1134438968 16:14286187-14286209 CCCTACACACAGCTACCCCTGGG No data
1134438963_1134438978 22 Left 1134438963 16:14286172-14286194 CCCCGGCGATCGGCTCCCTACAC No data
Right 1134438978 16:14286217-14286239 ATCCCCTGGGAGAAGATGGAGGG No data
1134438963_1134438982 28 Left 1134438963 16:14286172-14286194 CCCCGGCGATCGGCTCCCTACAC No data
Right 1134438982 16:14286223-14286245 TGGGAGAAGATGGAGGGCTCTGG No data
1134438963_1134438973 8 Left 1134438963 16:14286172-14286194 CCCCGGCGATCGGCTCCCTACAC No data
Right 1134438973 16:14286203-14286225 CCCTGGGGCGCTTCATCCCCTGG No data
1134438963_1134438966 -9 Left 1134438963 16:14286172-14286194 CCCCGGCGATCGGCTCCCTACAC No data
Right 1134438966 16:14286186-14286208 TCCCTACACACAGCTACCCCTGG No data
1134438963_1134438984 30 Left 1134438963 16:14286172-14286194 CCCCGGCGATCGGCTCCCTACAC No data
Right 1134438984 16:14286225-14286247 GGAGAAGATGGAGGGCTCTGGGG No data
1134438963_1134438977 21 Left 1134438963 16:14286172-14286194 CCCCGGCGATCGGCTCCCTACAC No data
Right 1134438977 16:14286216-14286238 CATCCCCTGGGAGAAGATGGAGG No data
1134438963_1134438975 9 Left 1134438963 16:14286172-14286194 CCCCGGCGATCGGCTCCCTACAC No data
Right 1134438975 16:14286204-14286226 CCTGGGGCGCTTCATCCCCTGGG No data
1134438963_1134438976 18 Left 1134438963 16:14286172-14286194 CCCCGGCGATCGGCTCCCTACAC No data
Right 1134438976 16:14286213-14286235 CTTCATCCCCTGGGAGAAGATGG No data
1134438963_1134438983 29 Left 1134438963 16:14286172-14286194 CCCCGGCGATCGGCTCCCTACAC No data
Right 1134438983 16:14286224-14286246 GGGAGAAGATGGAGGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134438963 Original CRISPR GTGTAGGGAGCCGATCGCCG GGG (reversed) Intergenic
No off target data available for this crispr