ID: 1134438969

View in Genome Browser
Species Human (GRCh38)
Location 16:14286188-14286210
Sequence CCCCAGGGGTAGCTGTGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134438969_1134438978 6 Left 1134438969 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
Right 1134438978 16:14286217-14286239 ATCCCCTGGGAGAAGATGGAGGG No data
1134438969_1134438983 13 Left 1134438969 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
Right 1134438983 16:14286224-14286246 GGGAGAAGATGGAGGGCTCTGGG No data
1134438969_1134438976 2 Left 1134438969 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
Right 1134438976 16:14286213-14286235 CTTCATCCCCTGGGAGAAGATGG No data
1134438969_1134438989 23 Left 1134438969 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
Right 1134438989 16:14286234-14286256 GGAGGGCTCTGGGGGTGGGGCGG No data
1134438969_1134438982 12 Left 1134438969 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
Right 1134438982 16:14286223-14286245 TGGGAGAAGATGGAGGGCTCTGG No data
1134438969_1134438986 18 Left 1134438969 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
Right 1134438986 16:14286229-14286251 AAGATGGAGGGCTCTGGGGGTGG No data
1134438969_1134438990 24 Left 1134438969 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
Right 1134438990 16:14286235-14286257 GAGGGCTCTGGGGGTGGGGCGGG No data
1134438969_1134438985 15 Left 1134438969 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
Right 1134438985 16:14286226-14286248 GAGAAGATGGAGGGCTCTGGGGG No data
1134438969_1134438987 19 Left 1134438969 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
Right 1134438987 16:14286230-14286252 AGATGGAGGGCTCTGGGGGTGGG No data
1134438969_1134438977 5 Left 1134438969 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
Right 1134438977 16:14286216-14286238 CATCCCCTGGGAGAAGATGGAGG No data
1134438969_1134438984 14 Left 1134438969 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
Right 1134438984 16:14286225-14286247 GGAGAAGATGGAGGGCTCTGGGG No data
1134438969_1134438975 -7 Left 1134438969 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
Right 1134438975 16:14286204-14286226 CCTGGGGCGCTTCATCCCCTGGG No data
1134438969_1134438973 -8 Left 1134438969 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
Right 1134438973 16:14286203-14286225 CCCTGGGGCGCTTCATCCCCTGG No data
1134438969_1134438988 20 Left 1134438969 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
Right 1134438988 16:14286231-14286253 GATGGAGGGCTCTGGGGGTGGGG No data
1134438969_1134438991 25 Left 1134438969 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
Right 1134438991 16:14286236-14286258 AGGGCTCTGGGGGTGGGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134438969 Original CRISPR CCCCAGGGGTAGCTGTGTGT AGG (reversed) Intergenic
No off target data available for this crispr