ID: 1134438973

View in Genome Browser
Species Human (GRCh38)
Location 16:14286203-14286225
Sequence CCCTGGGGCGCTTCATCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134438969_1134438973 -8 Left 1134438969 16:14286188-14286210 CCTACACACAGCTACCCCTGGGG No data
Right 1134438973 16:14286203-14286225 CCCTGGGGCGCTTCATCCCCTGG No data
1134438964_1134438973 7 Left 1134438964 16:14286173-14286195 CCCGGCGATCGGCTCCCTACACA No data
Right 1134438973 16:14286203-14286225 CCCTGGGGCGCTTCATCCCCTGG No data
1134438960_1134438973 24 Left 1134438960 16:14286156-14286178 CCGCAAATTTGGCCGGCCCCGGC No data
Right 1134438973 16:14286203-14286225 CCCTGGGGCGCTTCATCCCCTGG No data
1134438965_1134438973 6 Left 1134438965 16:14286174-14286196 CCGGCGATCGGCTCCCTACACAC No data
Right 1134438973 16:14286203-14286225 CCCTGGGGCGCTTCATCCCCTGG No data
1134438963_1134438973 8 Left 1134438963 16:14286172-14286194 CCCCGGCGATCGGCTCCCTACAC No data
Right 1134438973 16:14286203-14286225 CCCTGGGGCGCTTCATCCCCTGG No data
1134438962_1134438973 12 Left 1134438962 16:14286168-14286190 CCGGCCCCGGCGATCGGCTCCCT No data
Right 1134438973 16:14286203-14286225 CCCTGGGGCGCTTCATCCCCTGG No data
1134438967_1134438973 -7 Left 1134438967 16:14286187-14286209 CCCTACACACAGCTACCCCTGGG No data
Right 1134438973 16:14286203-14286225 CCCTGGGGCGCTTCATCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134438973 Original CRISPR CCCTGGGGCGCTTCATCCCC TGG Intergenic
No off target data available for this crispr