ID: 1134441437

View in Genome Browser
Species Human (GRCh38)
Location 16:14301873-14301895
Sequence GCTTCAAACAGGGGGCACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134441437_1134441450 12 Left 1134441437 16:14301873-14301895 CCTCCGTGCCCCCTGTTTGAAGC No data
Right 1134441450 16:14301908-14301930 GCCCCCCGCCCCCAGGGTCGAGG No data
1134441437_1134441448 5 Left 1134441437 16:14301873-14301895 CCTCCGTGCCCCCTGTTTGAAGC No data
Right 1134441448 16:14301901-14301923 GGGCTCTGCCCCCCGCCCCCAGG No data
1134441437_1134441449 6 Left 1134441437 16:14301873-14301895 CCTCCGTGCCCCCTGTTTGAAGC No data
Right 1134441449 16:14301902-14301924 GGCTCTGCCCCCCGCCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134441437 Original CRISPR GCTTCAAACAGGGGGCACGG AGG (reversed) Intergenic