ID: 1134441559

View in Genome Browser
Species Human (GRCh38)
Location 16:14302186-14302208
Sequence CCCTATGGCCGGCCCGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134441559_1134441576 -5 Left 1134441559 16:14302186-14302208 CCCGCCCCGGGCCGGCCATAGGG No data
Right 1134441576 16:14302204-14302226 TAGGGCGCTGGGGGGTTGGGGGG No data
1134441559_1134441585 19 Left 1134441559 16:14302186-14302208 CCCGCCCCGGGCCGGCCATAGGG No data
Right 1134441585 16:14302228-14302250 GCGGGGGCGCGGCTTTGTGGCGG No data
1134441559_1134441575 -6 Left 1134441559 16:14302186-14302208 CCCGCCCCGGGCCGGCCATAGGG No data
Right 1134441575 16:14302203-14302225 ATAGGGCGCTGGGGGGTTGGGGG No data
1134441559_1134441577 -4 Left 1134441559 16:14302186-14302208 CCCGCCCCGGGCCGGCCATAGGG No data
Right 1134441577 16:14302205-14302227 AGGGCGCTGGGGGGTTGGGGGGG No data
1134441559_1134441580 1 Left 1134441559 16:14302186-14302208 CCCGCCCCGGGCCGGCCATAGGG No data
Right 1134441580 16:14302210-14302232 GCTGGGGGGTTGGGGGGGGCGGG No data
1134441559_1134441583 8 Left 1134441559 16:14302186-14302208 CCCGCCCCGGGCCGGCCATAGGG No data
Right 1134441583 16:14302217-14302239 GGTTGGGGGGGGCGGGGGCGCGG No data
1134441559_1134441579 0 Left 1134441559 16:14302186-14302208 CCCGCCCCGGGCCGGCCATAGGG No data
Right 1134441579 16:14302209-14302231 CGCTGGGGGGTTGGGGGGGGCGG No data
1134441559_1134441586 25 Left 1134441559 16:14302186-14302208 CCCGCCCCGGGCCGGCCATAGGG No data
Right 1134441586 16:14302234-14302256 GCGCGGCTTTGTGGCGGCAGCGG No data
1134441559_1134441573 -8 Left 1134441559 16:14302186-14302208 CCCGCCCCGGGCCGGCCATAGGG No data
Right 1134441573 16:14302201-14302223 CCATAGGGCGCTGGGGGGTTGGG No data
1134441559_1134441584 16 Left 1134441559 16:14302186-14302208 CCCGCCCCGGGCCGGCCATAGGG No data
Right 1134441584 16:14302225-14302247 GGGGCGGGGGCGCGGCTTTGTGG No data
1134441559_1134441578 -3 Left 1134441559 16:14302186-14302208 CCCGCCCCGGGCCGGCCATAGGG No data
Right 1134441578 16:14302206-14302228 GGGCGCTGGGGGGTTGGGGGGGG No data
1134441559_1134441581 2 Left 1134441559 16:14302186-14302208 CCCGCCCCGGGCCGGCCATAGGG No data
Right 1134441581 16:14302211-14302233 CTGGGGGGTTGGGGGGGGCGGGG No data
1134441559_1134441571 -9 Left 1134441559 16:14302186-14302208 CCCGCCCCGGGCCGGCCATAGGG No data
Right 1134441571 16:14302200-14302222 GCCATAGGGCGCTGGGGGGTTGG No data
1134441559_1134441582 3 Left 1134441559 16:14302186-14302208 CCCGCCCCGGGCCGGCCATAGGG No data
Right 1134441582 16:14302212-14302234 TGGGGGGTTGGGGGGGGCGGGGG No data
1134441559_1134441574 -7 Left 1134441559 16:14302186-14302208 CCCGCCCCGGGCCGGCCATAGGG No data
Right 1134441574 16:14302202-14302224 CATAGGGCGCTGGGGGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134441559 Original CRISPR CCCTATGGCCGGCCCGGGGC GGG (reversed) Intergenic
No off target data available for this crispr