ID: 1134446479

View in Genome Browser
Species Human (GRCh38)
Location 16:14335143-14335165
Sequence CCCCCAACACTGCTGCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134446477_1134446479 -8 Left 1134446477 16:14335128-14335150 CCACAGACAATGTGACCCCCAAC No data
Right 1134446479 16:14335143-14335165 CCCCCAACACTGCTGCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134446479 Original CRISPR CCCCCAACACTGCTGCAGAA AGG Intergenic
No off target data available for this crispr