ID: 1134447287

View in Genome Browser
Species Human (GRCh38)
Location 16:14340522-14340544
Sequence AGCTACTCGGAAGGCTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134447287_1134447296 28 Left 1134447287 16:14340522-14340544 CCACCTCAGCCTTCCGAGTAGCT No data
Right 1134447296 16:14340573-14340595 GGCTAACTTTTTTTAGAGACAGG No data
1134447287_1134447297 29 Left 1134447287 16:14340522-14340544 CCACCTCAGCCTTCCGAGTAGCT No data
Right 1134447297 16:14340574-14340596 GCTAACTTTTTTTAGAGACAGGG No data
1134447287_1134447292 7 Left 1134447287 16:14340522-14340544 CCACCTCAGCCTTCCGAGTAGCT No data
Right 1134447292 16:14340552-14340574 CAAATGTATGTCACCATGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134447287 Original CRISPR AGCTACTCGGAAGGCTGAGG TGG (reversed) Intergenic