ID: 1134447291

View in Genome Browser
Species Human (GRCh38)
Location 16:14340535-14340557
Sequence CATTTGTTGTTCCAGCTACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134447291_1134447292 -6 Left 1134447291 16:14340535-14340557 CCGAGTAGCTGGAACAACAAATG No data
Right 1134447292 16:14340552-14340574 CAAATGTATGTCACCATGCCCGG No data
1134447291_1134447297 16 Left 1134447291 16:14340535-14340557 CCGAGTAGCTGGAACAACAAATG No data
Right 1134447297 16:14340574-14340596 GCTAACTTTTTTTAGAGACAGGG No data
1134447291_1134447296 15 Left 1134447291 16:14340535-14340557 CCGAGTAGCTGGAACAACAAATG No data
Right 1134447296 16:14340573-14340595 GGCTAACTTTTTTTAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134447291 Original CRISPR CATTTGTTGTTCCAGCTACT CGG (reversed) Intergenic