ID: 1134447296

View in Genome Browser
Species Human (GRCh38)
Location 16:14340573-14340595
Sequence GGCTAACTTTTTTTAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134447289_1134447296 25 Left 1134447289 16:14340525-14340547 CCTCAGCCTTCCGAGTAGCTGGA No data
Right 1134447296 16:14340573-14340595 GGCTAACTTTTTTTAGAGACAGG No data
1134447291_1134447296 15 Left 1134447291 16:14340535-14340557 CCGAGTAGCTGGAACAACAAATG No data
Right 1134447296 16:14340573-14340595 GGCTAACTTTTTTTAGAGACAGG No data
1134447287_1134447296 28 Left 1134447287 16:14340522-14340544 CCACCTCAGCCTTCCGAGTAGCT No data
Right 1134447296 16:14340573-14340595 GGCTAACTTTTTTTAGAGACAGG No data
1134447290_1134447296 19 Left 1134447290 16:14340531-14340553 CCTTCCGAGTAGCTGGAACAACA No data
Right 1134447296 16:14340573-14340595 GGCTAACTTTTTTTAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134447296 Original CRISPR GGCTAACTTTTTTTAGAGAC AGG Intergenic