ID: 1134453015

View in Genome Browser
Species Human (GRCh38)
Location 16:14374813-14374835
Sequence TTGGGGTCATGGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134453011_1134453015 -7 Left 1134453011 16:14374797-14374819 CCAGAATTAGGGTGGGTTGGGGT No data
Right 1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134453015 Original CRISPR TTGGGGTCATGGAGGGAAGA AGG Intergenic
No off target data available for this crispr