ID: 1134453746

View in Genome Browser
Species Human (GRCh38)
Location 16:14379167-14379189
Sequence AGGCATGGAGAGTGAGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134453746_1134453750 -5 Left 1134453746 16:14379167-14379189 CCCCAGGCTCACTCTCCATGCCT No data
Right 1134453750 16:14379185-14379207 TGCCTGCCCAGTGAGCCTCCTGG No data
1134453746_1134453751 -4 Left 1134453746 16:14379167-14379189 CCCCAGGCTCACTCTCCATGCCT No data
Right 1134453751 16:14379186-14379208 GCCTGCCCAGTGAGCCTCCTGGG No data
1134453746_1134453761 30 Left 1134453746 16:14379167-14379189 CCCCAGGCTCACTCTCCATGCCT No data
Right 1134453761 16:14379220-14379242 AGCCCTCAAGAATGTGCAGTGGG No data
1134453746_1134453760 29 Left 1134453746 16:14379167-14379189 CCCCAGGCTCACTCTCCATGCCT No data
Right 1134453760 16:14379219-14379241 GAGCCCTCAAGAATGTGCAGTGG No data
1134453746_1134453755 3 Left 1134453746 16:14379167-14379189 CCCCAGGCTCACTCTCCATGCCT No data
Right 1134453755 16:14379193-14379215 CAGTGAGCCTCCTGGGCCATCGG No data
1134453746_1134453756 7 Left 1134453746 16:14379167-14379189 CCCCAGGCTCACTCTCCATGCCT No data
Right 1134453756 16:14379197-14379219 GAGCCTCCTGGGCCATCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134453746 Original CRISPR AGGCATGGAGAGTGAGCCTG GGG (reversed) Intergenic
No off target data available for this crispr