ID: 1134453754

View in Genome Browser
Species Human (GRCh38)
Location 16:14379192-14379214
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134453754_1134453761 5 Left 1134453754 16:14379192-14379214 CCAGTGAGCCTCCTGGGCCATCG No data
Right 1134453761 16:14379220-14379242 AGCCCTCAAGAATGTGCAGTGGG No data
1134453754_1134453762 6 Left 1134453754 16:14379192-14379214 CCAGTGAGCCTCCTGGGCCATCG No data
Right 1134453762 16:14379221-14379243 GCCCTCAAGAATGTGCAGTGGGG No data
1134453754_1134453765 10 Left 1134453754 16:14379192-14379214 CCAGTGAGCCTCCTGGGCCATCG No data
Right 1134453765 16:14379225-14379247 TCAAGAATGTGCAGTGGGGTTGG No data
1134453754_1134453760 4 Left 1134453754 16:14379192-14379214 CCAGTGAGCCTCCTGGGCCATCG No data
Right 1134453760 16:14379219-14379241 GAGCCCTCAAGAATGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134453754 Original CRISPR CGATGGCCCAGGAGGCTCAC TGG (reversed) Intergenic
No off target data available for this crispr