ID: 1134453760

View in Genome Browser
Species Human (GRCh38)
Location 16:14379219-14379241
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134453754_1134453760 4 Left 1134453754 16:14379192-14379214 CCAGTGAGCCTCCTGGGCCATCG No data
Right 1134453760 16:14379219-14379241 GAGCCCTCAAGAATGTGCAGTGG No data
1134453748_1134453760 27 Left 1134453748 16:14379169-14379191 CCAGGCTCACTCTCCATGCCTGC No data
Right 1134453760 16:14379219-14379241 GAGCCCTCAAGAATGTGCAGTGG No data
1134453758_1134453760 -7 Left 1134453758 16:14379203-14379225 CCTGGGCCATCGGAAGGAGCCCT No data
Right 1134453760 16:14379219-14379241 GAGCCCTCAAGAATGTGCAGTGG No data
1134453753_1134453760 5 Left 1134453753 16:14379191-14379213 CCCAGTGAGCCTCCTGGGCCATC No data
Right 1134453760 16:14379219-14379241 GAGCCCTCAAGAATGTGCAGTGG No data
1134453746_1134453760 29 Left 1134453746 16:14379167-14379189 CCCCAGGCTCACTCTCCATGCCT No data
Right 1134453760 16:14379219-14379241 GAGCCCTCAAGAATGTGCAGTGG No data
1134453757_1134453760 -4 Left 1134453757 16:14379200-14379222 CCTCCTGGGCCATCGGAAGGAGC No data
Right 1134453760 16:14379219-14379241 GAGCCCTCAAGAATGTGCAGTGG No data
1134453747_1134453760 28 Left 1134453747 16:14379168-14379190 CCCAGGCTCACTCTCCATGCCTG No data
Right 1134453760 16:14379219-14379241 GAGCCCTCAAGAATGTGCAGTGG No data
1134453752_1134453760 9 Left 1134453752 16:14379187-14379209 CCTGCCCAGTGAGCCTCCTGGGC No data
Right 1134453760 16:14379219-14379241 GAGCCCTCAAGAATGTGCAGTGG No data
1134453749_1134453760 14 Left 1134453749 16:14379182-14379204 CCATGCCTGCCCAGTGAGCCTCC No data
Right 1134453760 16:14379219-14379241 GAGCCCTCAAGAATGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134453760 Original CRISPR GAGCCCTCAAGAATGTGCAG TGG Intergenic
No off target data available for this crispr