ID: 1134463386

View in Genome Browser
Species Human (GRCh38)
Location 16:14449747-14449769
Sequence GTTTTATTTTGCATTATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134463386_1134463388 20 Left 1134463386 16:14449747-14449769 CCATTCATAATGCAAAATAAAAC No data
Right 1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG 0: 1
1: 0
2: 0
3: 5
4: 70
1134463386_1134463387 8 Left 1134463386 16:14449747-14449769 CCATTCATAATGCAAAATAAAAC No data
Right 1134463387 16:14449778-14449800 AATATCACTTCTCACCCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134463386 Original CRISPR GTTTTATTTTGCATTATGAA TGG (reversed) Intronic
No off target data available for this crispr