ID: 1134463387

View in Genome Browser
Species Human (GRCh38)
Location 16:14449778-14449800
Sequence AATATCACTTCTCACCCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134463386_1134463387 8 Left 1134463386 16:14449747-14449769 CCATTCATAATGCAAAATAAAAC No data
Right 1134463387 16:14449778-14449800 AATATCACTTCTCACCCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134463387 Original CRISPR AATATCACTTCTCACCCACT AGG Intronic
No off target data available for this crispr