ID: 1134463388 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:14449790-14449812 |
Sequence | CACCCACTAGGTTTTTAGAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 76 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 70} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1134463386_1134463388 | 20 | Left | 1134463386 | 16:14449747-14449769 | CCATTCATAATGCAAAATAAAAC | No data | ||
Right | 1134463388 | 16:14449790-14449812 | CACCCACTAGGTTTTTAGACTGG | 0: 1 1: 0 2: 0 3: 5 4: 70 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1134463388 | Original CRISPR | CACCCACTAGGTTTTTAGAC TGG | Intronic | ||