ID: 1134463388

View in Genome Browser
Species Human (GRCh38)
Location 16:14449790-14449812
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134463386_1134463388 20 Left 1134463386 16:14449747-14449769 CCATTCATAATGCAAAATAAAAC No data
Right 1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type