ID: 1134463388

View in Genome Browser
Species Human (GRCh38)
Location 16:14449790-14449812
Sequence CACCCACTAGGTTTTTAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134463386_1134463388 20 Left 1134463386 16:14449747-14449769 CCATTCATAATGCAAAATAAAAC No data
Right 1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG 0: 1
1: 0
2: 0
3: 5
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134463388 Original CRISPR CACCCACTAGGTTTTTAGAC TGG Intronic
901441957 1:9283387-9283409 CACCAACTTGCTTTTCAGACAGG - Intergenic
907915944 1:58870202-58870224 CACGCACTAGGATTTTAGCAAGG - Intergenic
916245599 1:162685450-162685472 TACAAACTAGCTTTTTAGACTGG + Intronic
916262599 1:162857358-162857380 CACCCTGTAGGGTTTGAGACTGG - Intronic
917087212 1:171315835-171315857 CACTAACTAGGTCTCTAGACAGG + Intronic
919534509 1:198770211-198770233 CACCTACCAAGTTTTAAGACAGG + Intergenic
921856165 1:219987194-219987216 CACCTCCTTGGTTTTTAGAAGGG + Exonic
1075067811 10:119301434-119301456 CACCCACTATGTGTGGAGACAGG - Intronic
1078869458 11:15329954-15329976 GACCCACTAGGTTGCCAGACTGG - Intergenic
1080485997 11:32707248-32707270 CATTCACTGGGTTTTTTGACTGG - Intronic
1086878343 11:92124952-92124974 AGCACACTAGGTTTTTAGATTGG + Intergenic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1092363313 12:7856463-7856485 CACACATTAGTTTTTGAGACAGG - Intronic
1095353252 12:41240346-41240368 CACCCATTATGTTTTGAGACAGG - Intronic
1095501695 12:42846822-42846844 CACCCATGGGGTTTGTAGACAGG + Intergenic
1105056356 12:133103304-133103326 CACCCCCTTTGTTTTAAGACAGG + Intronic
1106334447 13:28770525-28770547 CATCATCTAGGTTTTAAGACTGG + Intergenic
1117839707 14:59846939-59846961 CAGACACTAGGTTTCTAGAATGG - Intronic
1127023202 15:54774498-54774520 CACCCATGGGGTTTTTGGACAGG + Intergenic
1127113334 15:55698294-55698316 CACCCACTCCATTCTTAGACAGG + Intronic
1131217095 15:90546925-90546947 CACCTGCTAGGATTTTAAACAGG + Intronic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1135908931 16:26541615-26541637 CACCCACTTGGTTGTTACATTGG - Intergenic
1139116159 16:63956138-63956160 CACACACTAGGCTTTTAGAGAGG - Intergenic
1141151713 16:81568806-81568828 CACCCACTCGCCTTTCAGACTGG - Intronic
1156797221 18:41061224-41061246 CACCCACTGGGTTCCTAGTCCGG + Intergenic
1163252500 19:16134514-16134536 CACACACTATGCTTTTAGATAGG + Intronic
1163979384 19:20884546-20884568 CACCCACAAGGTCATTAGAGTGG + Intergenic
928341731 2:30448653-30448675 CCCCCACCAGGTCTTTAGGCTGG + Intronic
929939508 2:46322233-46322255 CACCCGCTAGGTTCTTATGCTGG + Intronic
931324579 2:61205973-61205995 CTTCCACTAGGTTTTTACACGGG + Intronic
931965806 2:67533206-67533228 CACCCACTAGGCTGTTAGCAGGG + Intergenic
937619129 2:123965423-123965445 CACCCATTAGGTTTCCAGAATGG - Intergenic
943239843 2:185368463-185368485 CAAGCACTAGGATTTTAGGCAGG - Intergenic
943325131 2:186488353-186488375 CAGCCACTAATTTTTTTGACAGG + Intronic
1170282590 20:14667618-14667640 CACACACAAGCATTTTAGACGGG + Intronic
1174369793 20:50078810-50078832 CACACTCTAGGATTTGAGACAGG + Intergenic
1178300887 21:31451929-31451951 CAGCCACCAGATTTTTAGTCTGG - Intronic
1183173641 22:36205830-36205852 CACACACCAGCTTTTGAGACAGG + Intergenic
1183276828 22:36903723-36903745 CTCCCAGTAGGTGTTTAGAAGGG + Intergenic
1184904903 22:47475483-47475505 TACCCAGTAGGGTTTTACACAGG + Intronic
960440446 3:117680712-117680734 CACCTACTAGATTTATAGACTGG - Intergenic
964735492 3:159912918-159912940 TACCCACAAGGTTTTTATAAGGG + Intergenic
970355213 4:15244744-15244766 GACCCAATAGGCTTTTGGACAGG - Intergenic
973687458 4:53386982-53387004 CCCTAATTAGGTTTTTAGACAGG + Intronic
977683151 4:99817031-99817053 CACCCACTAGGTACTTTGAAAGG - Intronic
983191926 4:164763783-164763805 CACCCACTAGGTTAATAAGCAGG - Intergenic
999041869 5:148422801-148422823 AAACCACTAGGTTTTTATGCAGG - Intronic
1000062155 5:157667433-157667455 CAGCCTCAAGGTTTTTAAACTGG - Intronic
1002484496 5:179524833-179524855 CACCCACCAGGTGTGTGGACAGG - Intergenic
1002500083 5:179642655-179642677 CACCCACCAGGTGTGTGGACAGG + Intronic
1002501888 5:179652106-179652128 CACCCACCAGGTGTGTGGACAGG - Intergenic
1004642394 6:17527992-17528014 CACCACCTATGTTTTTAGAAGGG + Intronic
1006612261 6:35301222-35301244 CAGCCAGCAGGTTTTTGGACTGG - Intronic
1006781597 6:36636098-36636120 CATTCAATAGGTCTTTAGACTGG + Intergenic
1008200799 6:48587337-48587359 GACCCACTAGCTTCTTTGACAGG + Intergenic
1016025330 6:139281123-139281145 AACCCACTAATTTTATAGACAGG - Intronic
1016053193 6:139551530-139551552 ACCACACTAGGTTTGTAGACAGG - Intergenic
1018299023 6:162380050-162380072 CACCCACTAGTATATTATACTGG + Intronic
1022283194 7:28931064-28931086 CACCATCTAGGTTTTAAGCCCGG + Intergenic
1025590200 7:62849615-62849637 CACACAGTAGTTTTTCAGACAGG - Intergenic
1032422952 7:131797863-131797885 CATCCACTAGGTTTATGGACAGG + Intergenic
1034966909 7:155397301-155397323 CACCCAATAGGGTTTTTGAAAGG - Intergenic
1039327536 8:36501789-36501811 CACTAACTAGGTTTTTACAAAGG - Intergenic
1045714554 8:105026302-105026324 GACACACTAGGTATTTAGATGGG + Intronic
1049708831 8:144054723-144054745 CACCCGCTAGGTGTTTTGGCCGG - Exonic
1057302449 9:93894709-93894731 CACCCACTTGGTTTCTAAATTGG + Intergenic
1058808985 9:108620676-108620698 TACACAGTAGGTTTTTAGCCTGG + Intergenic
1062027095 9:134345573-134345595 CACCCACTAGGTGTTCATCCAGG + Intronic
1186948373 X:14594849-14594871 CAGCCACTGGGATTTTAGTCAGG + Intronic
1187685508 X:21811929-21811951 AAGCCACTAGATTTTTAGAATGG - Intergenic
1196509552 X:116491707-116491729 CACCCACAATTTTTTAAGACAGG - Intergenic
1201050809 Y:9933010-9933032 CATTCATTAGGTTTTTAGAATGG - Intergenic