ID: 1134473461 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:14549312-14549334 |
| Sequence | GAATAGGGAATATGGGGAAT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1134473461_1134473468 | 17 | Left | 1134473461 | 16:14549312-14549334 | CCTATTCCCCATATTCCCTATTC | No data | ||
| Right | 1134473468 | 16:14549352-14549374 | CTCATGCTGCAGTGTGTGTCAGG | No data | ||||
| 1134473461_1134473469 | 28 | Left | 1134473461 | 16:14549312-14549334 | CCTATTCCCCATATTCCCTATTC | No data | ||
| Right | 1134473469 | 16:14549363-14549385 | GTGTGTGTCAGGTATGAGAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1134473461 | Original CRISPR | GAATAGGGAATATGGGGAAT AGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||