ID: 1134473461

View in Genome Browser
Species Human (GRCh38)
Location 16:14549312-14549334
Sequence GAATAGGGAATATGGGGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134473461_1134473468 17 Left 1134473461 16:14549312-14549334 CCTATTCCCCATATTCCCTATTC No data
Right 1134473468 16:14549352-14549374 CTCATGCTGCAGTGTGTGTCAGG No data
1134473461_1134473469 28 Left 1134473461 16:14549312-14549334 CCTATTCCCCATATTCCCTATTC No data
Right 1134473469 16:14549363-14549385 GTGTGTGTCAGGTATGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134473461 Original CRISPR GAATAGGGAATATGGGGAAT AGG (reversed) Intronic
No off target data available for this crispr