ID: 1134475029

View in Genome Browser
Species Human (GRCh38)
Location 16:14566079-14566101
Sequence ACTACTAACCTGCCTACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134475027_1134475029 15 Left 1134475027 16:14566041-14566063 CCAATGCAAGGCTGGAAATAGCT No data
Right 1134475029 16:14566079-14566101 ACTACTAACCTGCCTACAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 58
1134475024_1134475029 26 Left 1134475024 16:14566030-14566052 CCAAGCCAGGACCAATGCAAGGC No data
Right 1134475029 16:14566079-14566101 ACTACTAACCTGCCTACAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 58
1134475026_1134475029 21 Left 1134475026 16:14566035-14566057 CCAGGACCAATGCAAGGCTGGAA No data
Right 1134475029 16:14566079-14566101 ACTACTAACCTGCCTACAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134475029 Original CRISPR ACTACTAACCTGCCTACAGT GGG Intronic
906765620 1:48429070-48429092 AGTACTTATCTGCCTGCAGTGGG - Intronic
907102401 1:51848938-51848960 ACTACTAAACAGCCAACATTAGG + Intronic
907893701 1:58663029-58663051 ATTACTACCTTGCTTACAGTAGG - Intronic
910952749 1:92668332-92668354 ACTACTATGCTGCACACAGTAGG - Intronic
911843766 1:102721265-102721287 AAAGCTAACCTCCCTACAGTAGG + Intergenic
919685284 1:200478684-200478706 ACACCCATCCTGCCTACAGTGGG - Intergenic
920026636 1:203003271-203003293 TATACTAAACTGCCTTCAGTAGG + Intergenic
922928843 1:229373270-229373292 AATTCTCTCCTGCCTACAGTGGG + Intergenic
924787547 1:247212062-247212084 ACTAGTTACCTGCAAACAGTAGG - Intergenic
1064804089 10:19110918-19110940 ATTCCTAACTTCCCTACAGTAGG - Intronic
1087139870 11:94754726-94754748 AATACCAACCTACCTACACTAGG - Intronic
1098724577 12:73946800-73946822 AATACCTACCTGCCTAAAGTAGG - Intergenic
1108441003 13:50452727-50452749 TCTACTAACCAGCCAACAATAGG + Intronic
1109171215 13:59099302-59099324 AGAACTAGCCTGCCTACTGTAGG + Intergenic
1115031940 14:28806141-28806163 ACAAACAACCTGCCTGCAGTAGG - Intronic
1122030685 14:98909303-98909325 ATCACTAACTTGACTACAGTCGG + Intergenic
1125281283 15:38044654-38044676 ACTACTACTCTGGCTACAGCCGG + Intergenic
1127640670 15:60913083-60913105 ACTGATAATCTGCCTAAAGTAGG + Intronic
1127728569 15:61777003-61777025 AATTCTAACCTGCCTTCTGTGGG + Intergenic
1134107176 16:11493509-11493531 ACTAGTACCCAGCCCACAGTAGG + Intronic
1134475029 16:14566079-14566101 ACTACTAACCTGCCTACAGTGGG + Intronic
1142896913 17:2986088-2986110 ACTATTAACCTGCCATTAGTAGG - Intronic
1150658571 17:67056470-67056492 AGTCCTAACCTGGCCACAGTTGG + Exonic
1151463944 17:74272622-74272644 ACTACCCACCTGCCTTTAGTGGG - Intergenic
1151831635 17:76555854-76555876 ATTACTATCTTGTCTACAGTAGG + Intergenic
927804105 2:26130091-26130113 AAAACTAAACTGCCTATAGTCGG - Intronic
931087428 2:58848530-58848552 ACTTCTAAGTTGCCAACAGTTGG + Intergenic
935027790 2:99293817-99293839 AGTACTAAGATACCTACAGTAGG + Intronic
944300459 2:198118752-198118774 ACTACTCACATGCATTCAGTGGG - Intronic
948099747 2:235364460-235364482 ACTGTTAACTTCCCTACAGTCGG - Intergenic
1176253477 20:64138295-64138317 ACAAGGAACCTGCATACAGTAGG - Intergenic
1181818759 22:25459427-25459449 ACTAGTACCCTGGCTACCGTGGG + Intergenic
958839618 3:99187356-99187378 CATGCTAAGCTGCCTACAGTTGG - Intergenic
959739493 3:109699915-109699937 ACTACTAAACTGTCTACCTTGGG + Intergenic
960391492 3:117082674-117082696 TCTACCAACCTGCCTGCACTTGG + Intronic
963682883 3:148402641-148402663 ACTACTAACTTGCCTAGTGTTGG + Intergenic
965199862 3:165643771-165643793 ACTACTCATCTGACCACAGTGGG - Intergenic
969169520 4:5348728-5348750 ACCACAACCCTGCCTACAATAGG + Intronic
973195670 4:47437004-47437026 ACTACTATCCTGCCAGCAATGGG + Intergenic
975051829 4:69874843-69874865 ATTACTATCATACCTACAGTGGG + Intergenic
975211935 4:71711184-71711206 ACAACTAAACTGCTTACAGGAGG - Intergenic
987366389 5:17152743-17152765 ACAACTGACCAGTCTACAGTGGG - Intronic
991066870 5:62433392-62433414 TATACGAACGTGCCTACAGTTGG - Intronic
991171784 5:63635259-63635281 ACTAGTAATCTGACTAAAGTGGG - Intergenic
993225150 5:85160297-85160319 ATTAATTACCTGCCTACATTTGG + Intergenic
998630813 5:143896683-143896705 AGTACTACCCTGCCTACAACTGG - Intergenic
1014942575 6:127460397-127460419 AATAGTAACCTGCTCACAGTAGG + Intronic
1016794526 6:148103867-148103889 ACTAATAACCTGCCCAAATTAGG - Intergenic
1017880861 6:158561364-158561386 ACTGCTAACCTACCTCCACTTGG - Intronic
1033286766 7:140048133-140048155 GCTGCTGACCTGCCTTCAGTTGG - Intronic
1041493219 8:58457962-58457984 AATACCAACTTGCTTACAGTAGG - Intergenic
1041709371 8:60879231-60879253 ACCACTAATCTGCTTTCAGTGGG + Intergenic
1043297768 8:78686225-78686247 ACTACTAAACTGCCTTCTGTAGG - Intronic
1044298505 8:90556152-90556174 CCTACAAACCTCACTACAGTGGG + Intergenic
1047780847 8:128109732-128109754 ACTATTAAAATGCCTACAGGAGG + Intergenic
1062471430 9:136707252-136707274 AGTCCTAACCTGCCCACAGGTGG - Intergenic
1188848702 X:35105598-35105620 ACTACTAAACTGAATACAGCAGG + Intergenic
1191058737 X:56271914-56271936 ATTTCCAACCTGCCTACACTTGG - Intronic
1196534488 X:116826365-116826387 ACAACTACCCTGTCTATAGTAGG + Intergenic
1197836921 X:130704878-130704900 ACTACTAAAGTTCCTACAGATGG - Intronic
1201433267 Y:13928028-13928050 ACTTCTAACCTGACTACCTTTGG - Intergenic