ID: 1134481243 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:14621246-14621268 |
Sequence | TTCAGTGCCTTTGTCAGAGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1134481243_1134481244 | -10 | Left | 1134481243 | 16:14621246-14621268 | CCATCTCTGACAAAGGCACTGAA | No data | ||
Right | 1134481244 | 16:14621259-14621281 | AGGCACTGAAACACAAACTGTGG | No data | ||||
1134481243_1134481245 | -6 | Left | 1134481243 | 16:14621246-14621268 | CCATCTCTGACAAAGGCACTGAA | No data | ||
Right | 1134481245 | 16:14621263-14621285 | ACTGAAACACAAACTGTGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1134481243 | Original CRISPR | TTCAGTGCCTTTGTCAGAGA TGG (reversed) | Intronic | ||
No off target data available for this crispr |