ID: 1134481243

View in Genome Browser
Species Human (GRCh38)
Location 16:14621246-14621268
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134481243_1134481244 -10 Left 1134481243 16:14621246-14621268 CCATCTCTGACAAAGGCACTGAA No data
Right 1134481244 16:14621259-14621281 AGGCACTGAAACACAAACTGTGG No data
1134481243_1134481245 -6 Left 1134481243 16:14621246-14621268 CCATCTCTGACAAAGGCACTGAA No data
Right 1134481245 16:14621263-14621285 ACTGAAACACAAACTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134481243 Original CRISPR TTCAGTGCCTTTGTCAGAGA TGG (reversed) Intronic
No off target data available for this crispr