ID: 1134481245

View in Genome Browser
Species Human (GRCh38)
Location 16:14621263-14621285
Sequence ACTGAAACACAAACTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134481240_1134481245 7 Left 1134481240 16:14621233-14621255 CCACCTAAACATTCCATCTCTGA No data
Right 1134481245 16:14621263-14621285 ACTGAAACACAAACTGTGGAAGG No data
1134481239_1134481245 8 Left 1134481239 16:14621232-14621254 CCCACCTAAACATTCCATCTCTG No data
Right 1134481245 16:14621263-14621285 ACTGAAACACAAACTGTGGAAGG No data
1134481241_1134481245 4 Left 1134481241 16:14621236-14621258 CCTAAACATTCCATCTCTGACAA No data
Right 1134481245 16:14621263-14621285 ACTGAAACACAAACTGTGGAAGG No data
1134481243_1134481245 -6 Left 1134481243 16:14621246-14621268 CCATCTCTGACAAAGGCACTGAA No data
Right 1134481245 16:14621263-14621285 ACTGAAACACAAACTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134481245 Original CRISPR ACTGAAACACAAACTGTGGA AGG Intronic
No off target data available for this crispr