ID: 1134506262

View in Genome Browser
Species Human (GRCh38)
Location 16:14809957-14809979
Sequence GAGCCTTTATGGCCCTCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134506256_1134506262 4 Left 1134506256 16:14809930-14809952 CCACTCGCCCAATATCCATCTAG No data
Right 1134506262 16:14809957-14809979 GAGCCTTTATGGCCCTCATAAGG No data
1134506255_1134506262 5 Left 1134506255 16:14809929-14809951 CCCACTCGCCCAATATCCATCTA No data
Right 1134506262 16:14809957-14809979 GAGCCTTTATGGCCCTCATAAGG No data
1134506259_1134506262 -4 Left 1134506259 16:14809938-14809960 CCAATATCCATCTAGCTTGGAGC No data
Right 1134506262 16:14809957-14809979 GAGCCTTTATGGCCCTCATAAGG No data
1134506258_1134506262 -3 Left 1134506258 16:14809937-14809959 CCCAATATCCATCTAGCTTGGAG No data
Right 1134506262 16:14809957-14809979 GAGCCTTTATGGCCCTCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134506262 Original CRISPR GAGCCTTTATGGCCCTCATA AGG Intronic
No off target data available for this crispr