ID: 1134507140

View in Genome Browser
Species Human (GRCh38)
Location 16:14817244-14817266
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154563
Summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134507140 Original CRISPR CACTTGAATCCAGGAGACGG CGG (reversed) Intronic
Too many off-targets to display for this crispr