ID: 1134508804

View in Genome Browser
Species Human (GRCh38)
Location 16:14829656-14829678
Sequence GATATTATTCCTAATATCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134508798_1134508804 30 Left 1134508798 16:14829603-14829625 CCGAGGGAGATATTACTTCCAAT No data
Right 1134508804 16:14829656-14829678 GATATTATTCCTAATATCCGTGG No data
1134508801_1134508804 12 Left 1134508801 16:14829621-14829643 CCAATATCAAAGTGGGTGTGATA No data
Right 1134508804 16:14829656-14829678 GATATTATTCCTAATATCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134508804 Original CRISPR GATATTATTCCTAATATCCG TGG Intronic
No off target data available for this crispr