ID: 1134508805

View in Genome Browser
Species Human (GRCh38)
Location 16:14829657-14829679
Sequence ATATTATTCCTAATATCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134508801_1134508805 13 Left 1134508801 16:14829621-14829643 CCAATATCAAAGTGGGTGTGATA No data
Right 1134508805 16:14829657-14829679 ATATTATTCCTAATATCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134508805 Original CRISPR ATATTATTCCTAATATCCGT GGG Intronic
No off target data available for this crispr