ID: 1134509276

View in Genome Browser
Species Human (GRCh38)
Location 16:14833706-14833728
Sequence GCGCGCGTGCGCGGCGGCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 2, 1: 0, 2: 1, 3: 25, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134509266_1134509276 28 Left 1134509266 16:14833655-14833677 CCGAGCATGCGCCTTAGTTCTCT 0: 3
1: 0
2: 0
3: 3
4: 77
Right 1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG 0: 2
1: 0
2: 1
3: 25
4: 225
1134509270_1134509276 17 Left 1134509270 16:14833666-14833688 CCTTAGTTCTCTCTTCTGGGGCT 0: 3
1: 0
2: 1
3: 17
4: 227
Right 1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG 0: 2
1: 0
2: 1
3: 25
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134509276 Original CRISPR GCGCGCGTGCGCGGCGGCTC TGG Exonic
901109772 1:6785439-6785461 GGGCGGGTGCGCGGCGGCGGCGG + Exonic
903206019 1:21783104-21783126 GCGGGCGGGCGCGGCGGCAGTGG - Exonic
903597019 1:24502809-24502831 GGGCGCGCGCACGGCGGCGCAGG - Intronic
904794773 1:33051091-33051113 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
906436815 1:45803576-45803598 GCGCGCGTGAGGGGCGGGGCCGG + Intronic
906436877 1:45803817-45803839 GCGCGGCTGCGCTGCGGCCCGGG + Exonic
906486604 1:46240252-46240274 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
908131816 1:61082302-61082324 GCGAGCGGCCGCGGAGGCTCGGG + Intronic
908534758 1:65067153-65067175 GAGCGCGGGGGCGGCGGCGCGGG - Intergenic
912411567 1:109483935-109483957 GCGCGCGTCCGCGGCGGTGATGG + Exonic
912717085 1:111990241-111990263 GCGCGCGTGAGCGGGGGGTGGGG + Intergenic
915142495 1:153776127-153776149 GCGCGCGCGCGCCGCAGCTGCGG - Exonic
920528747 1:206686163-206686185 ACGCCCGCGCGGGGCGGCTCCGG + Intronic
920924489 1:210328896-210328918 GCGCGCGGGCACGGCGGCAGGGG + Exonic
921189874 1:212699785-212699807 GCGCGCGGGCGGGGCGGGGCGGG - Exonic
921384073 1:214551822-214551844 GCGCGCGCCCGCGGCGCCCCCGG - Intronic
921603981 1:217135518-217135540 GGGCGCGCGCGCGGCGGCGGCGG + Intronic
1065845152 10:29737085-29737107 GCGCACGCGCCCAGCGGCTCAGG + Intergenic
1066022876 10:31319942-31319964 GCGCGCGTGTGCGCGGGCGCCGG + Intronic
1068472210 10:57479808-57479830 GCGGCCGGGCGCGGTGGCTCAGG + Intergenic
1070032641 10:72692306-72692328 GCGAGCGCGCCCGGAGGCTCCGG + Intronic
1072950172 10:99840350-99840372 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1073450035 10:103603669-103603691 GCGTGCTTGTGCGGCGGCTCAGG + Exonic
1073503841 10:103967036-103967058 GCGCGCGTGCGCGGGGCCAGAGG + Intergenic
1075119026 10:119651225-119651247 GCGCCCGCCCGCGGCGACTCCGG + Intergenic
1077049646 11:560957-560979 GCCCGGGTGCGCCGCGGCGCTGG + Intronic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1081873407 11:46393108-46393130 GCTCGCGAGCGCGACGGCTGGGG + Intergenic
1082787420 11:57324632-57324654 GCGCGTGTGCGCGGAGGCGGAGG - Intronic
1084517014 11:69642760-69642782 GGCGGCGTGCGCGGCGGCGCGGG - Intronic
1085666326 11:78417998-78418020 GTCCGCGTGCGCGGCGGCCTCGG - Intronic
1090788362 11:130069616-130069638 GGGCGTGCGCGCGGCGGGTCTGG - Intergenic
1091558671 12:1594423-1594445 GGGCGTGGGCGCGGCGGCGCGGG - Intronic
1091616202 12:2052926-2052948 GGGCGCGGGCGCGGCGGGGCTGG + Intronic
1093958677 12:25250559-25250581 GCGCGCGGACGCGGCGGCGCGGG - Intronic
1094564984 12:31591019-31591041 GGGCTCGCGCGCGGCGGGTCCGG + Exonic
1095439296 12:42226950-42226972 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1096460876 12:51821001-51821023 GCGCGCGCCCTCGGCGGCGCCGG + Intergenic
1096647803 12:53047863-53047885 GCGAGGGAGGGCGGCGGCTCTGG - Intronic
1101680009 12:106955784-106955806 GCGCGCGTGCGCGTCGGAACTGG + Exonic
1102453513 12:113057524-113057546 GCGCGCCTGGACTGCGGCTCCGG - Intronic
1102884101 12:116508676-116508698 GCGCGCCTGAGCAGCGGCCCTGG - Intergenic
1103954091 12:124567109-124567131 GCCCGCGTGCTCGGGGGCGCCGG - Intronic
1104961570 12:132490588-132490610 GCGCGCGCGAGCGCCGGCTCGGG - Exonic
1104961612 12:132490731-132490753 GGGCGCGGGGGCGGCGCCTCGGG - Exonic
1108408305 13:50125434-50125456 GGGGGCGGGCGCGGCGGCGCGGG - Intronic
1113655607 13:112066661-112066683 GCGCGCGCGCGCGGCGGCGGCGG - Intergenic
1113841489 13:113363981-113364003 GCGGGCGTCCCCGGCGGCTGCGG - Intronic
1115398558 14:32934810-32934832 GCCCCCGGGCGCGGCGGCTCTGG - Intergenic
1117875927 14:60249719-60249741 GCGGGCCTGCGCGGCGGCGGCGG + Intronic
1120809930 14:88792831-88792853 GCGTGCGCGGGCGGCGGCTGAGG - Intergenic
1121226176 14:92323396-92323418 GCGAGTGGGCGCGGCGGCGCGGG + Intronic
1122964070 14:105112920-105112942 GCGCGGCTGCGCTGCGGCCCGGG - Intergenic
1122993333 14:105249099-105249121 GCGCGCGGGCGCGGGGGCCGCGG - Intronic
1123630743 15:22258206-22258228 GCGCGCGGGCGCCGCGGGCCGGG - Intergenic
1124999458 15:34755101-34755123 GCGCGCGTCCCCGGCCCCTCGGG - Intergenic
1126766990 15:52019404-52019426 GTGCGCCGGCGGGGCGGCTCGGG + Intronic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1131055359 15:89371598-89371620 GCCCGAGCGCGCGGCGGGTCGGG + Intergenic
1132365173 15:101251702-101251724 GCGCGCGCTAGCGGCGGCTCGGG + Exonic
1132552811 16:560357-560379 GCGCGCGTGCGCCTGGGCTCCGG - Intergenic
1132947131 16:2537951-2537973 GCGCGGGGGCGGGGCGGCGCCGG + Exonic
1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG + Exonic
1134519351 16:14911618-14911640 GCGCGCGGAGGCCGCGGCTCAGG - Intronic
1134554582 16:15154610-15154632 GCGCGCGGAGGCCGCGGCTCAGG + Intergenic
1134707021 16:16310273-16310295 GCGCGCGGAGGCCGCGGCTCAGG - Intergenic
1134960519 16:18401851-18401873 GCGCGCGGAGGCCGCGGCTCAGG + Intergenic
1134974861 16:18562164-18562186 GCGCGCGTGCGCGGCGGCTCTGG - Intronic
1135034855 16:19068368-19068390 GAGCCCGGGCGCGGTGGCTCCGG + Intronic
1137300252 16:47142980-47143002 GCGCGCGGGCGCCGCGGACCCGG - Intronic
1137531762 16:49282407-49282429 GCGTGCGCGCGCGGCGGGGCGGG + Intergenic
1138327941 16:56191244-56191266 GCGCGTGTGCGCGCCGCCGCCGG + Intergenic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1139467116 16:67159936-67159958 GCGGGCGGACGGGGCGGCTCGGG - Exonic
1141972302 16:87492367-87492389 GCGCGCGGGCGCCGCGGGCCGGG + Intergenic
1142154640 16:88527515-88527537 GCGCGTGAGCGGGCCGGCTCAGG + Intronic
1142549915 17:732344-732366 ACGCGCGCGCGCCGCGGCCCCGG + Intergenic
1142863373 17:2776685-2776707 CTGCGCGTGCGCGGCGGCGGCGG + Intergenic
1143016369 17:3893057-3893079 GCCCGCGGGCGCCGCGGCTCCGG + Intronic
1143036920 17:4004766-4004788 GCGCCGGGACGCGGCGGCTCTGG + Exonic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1144107274 17:11997404-11997426 GCGCGCTTGCGGGGCGGTCCCGG - Intronic
1144787472 17:17840106-17840128 GCGCGCGTGCGGAGCCGCCCCGG - Intergenic
1147168673 17:38605953-38605975 GCGCGCGCGCGGGCCGGCGCGGG + Intergenic
1147617083 17:41836031-41836053 GCGCGCGTGTGAGGCGGGGCCGG + Intronic
1147741036 17:42671073-42671095 GCGCGAATGCGTTGCGGCTCCGG + Exonic
1147864957 17:43545983-43546005 GCGCGCGCGCGCGGAGGAGCAGG + Intronic
1147963136 17:44179794-44179816 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1150643552 17:66964858-66964880 GCGGGCGGGCGCGGCGGGCCGGG + Intergenic
1150802250 17:68291510-68291532 GCGCGCGACCGGCGCGGCTCAGG - Intronic
1150830341 17:68512776-68512798 GAGCGCGAGCGGGGCGGCTGGGG - Intronic
1152426452 17:80220845-80220867 GCGCGCGGGCGCCGGGGCCCTGG + Intronic
1152748509 17:82051983-82052005 GCGCGGGGGCGCGGAGGCCCGGG - Exonic
1152751802 17:82065726-82065748 GCGGGCGTTCGCGGCGCCCCGGG - Intronic
1153911278 18:9708343-9708365 GGGCGCGGGCGCGGCGGCCCCGG + Exonic
1156448615 18:37254100-37254122 GCGCGCGTGCTAGGCCCCTCCGG + Intronic
1160204503 18:76822283-76822305 GGGCGCATGCGCGGCGCCGCGGG - Exonic
1160454726 18:78992544-78992566 GCGCGCGCGGCAGGCGGCTCGGG + Exonic
1160668440 19:344519-344541 GTGCGCATGCGCGGCGGCGCGGG - Intronic
1160763606 19:797651-797673 GCGCGGGTGCGGGGCGGGTCAGG + Intronic
1160765559 19:806068-806090 GCGCGCATGCGCGGTGGTCCCGG + Intronic
1160823445 19:1068524-1068546 CCGCGCTGGCGTGGCGGCTCAGG - Exonic
1160948029 19:1652403-1652425 TCGCGCGTGGGCGGCGGCGGCGG + Intronic
1161080631 19:2308266-2308288 GGCCGCGTGCGCGGCGGCTGGGG + Intronic
1161153569 19:2721385-2721407 GGGCGCGACTGCGGCGGCTCGGG - Exonic
1161290584 19:3491662-3491684 GCACGAGTGCGCGGAGGCCCTGG - Exonic
1162886642 19:13702551-13702573 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1162954360 19:14090209-14090231 GCGCGCGTGCGCTCCGGCTCCGG + Exonic
1163329679 19:16628332-16628354 GCGCGCTTGCGCGGAGGCGCGGG - Intronic
1164191861 19:22925298-22925320 GCGCGGCTGCGCTGCGGCCCAGG + Intergenic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1164653388 19:29901926-29901948 GCGCGGCTGCGCTGCGGCCCGGG - Intergenic
1164835148 19:31350974-31350996 GCGCCCGGGCGCGCCGGCTGGGG + Intergenic
1165311300 19:35030700-35030722 GCGCGCGGGCGCAGCAGCTGCGG - Intronic
1166261380 19:41643977-41643999 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1167000267 19:46741641-46741663 GAGCGCATGCTCTGCGGCTCTGG - Intronic
1168351029 19:55675491-55675513 GCCCGCGCGCGCCGCGGCCCAGG - Intronic
1168718934 19:58544397-58544419 ATGCGCGTGCGCGGCGGCGTCGG + Intronic
1202710755 1_KI270714v1_random:18299-18321 GCGGGCGGGGGCGGCGGCTGCGG + Intergenic
924987692 2:287357-287379 GCGCGCGTGAGCTGCGGCGCGGG - Intronic
925984873 2:9207235-9207257 GGCGGCCTGCGCGGCGGCTCCGG + Intronic
927156510 2:20224342-20224364 GCGCCCGGGCTCGGCGGCGCTGG + Intronic
928143540 2:28751677-28751699 GTGCGGTTGCGCGGCGGCCCAGG + Intronic
932699976 2:73985402-73985424 CCGCGCGCGCGCCGCCGCTCGGG - Intergenic
934566978 2:95346603-95346625 GCGCGGGGGCGCGGCGGCGGCGG - Intronic
936433243 2:112482180-112482202 GCGCCCGGGCGCGGCGCCGCCGG + Exonic
938338978 2:130522998-130523020 GCGCGCGGGTGCGGGGGCGCGGG + Intronic
938350860 2:130597752-130597774 GCGCGCGGGTGCGGGGGCGCGGG - Intronic
939153803 2:138501753-138501775 GCGCGTGCGCGCGGCGGCGGCGG - Intergenic
941026677 2:160463500-160463522 GCGGCCGGGCGCGGTGGCTCAGG + Intronic
944766645 2:202871470-202871492 GCGCGCGCGCGCGGCTTCTCGGG - Exonic
947549899 2:231038225-231038247 GCGCGGGCGGGCGGTGGCTCGGG + Intronic
947593078 2:231395966-231395988 GCGGGCGGGCGCGGCGGCGGCGG + Intronic
947741714 2:232487775-232487797 GCTCGGCTGCGCTGCGGCTCAGG - Exonic
948140865 2:235670843-235670865 GCGCGCGCGGGCGGCGGCCGGGG + Intronic
948893092 2:240916468-240916490 GCGCGGGGGCGCGGGGGCACGGG - Intergenic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949051461 2:241899784-241899806 GCGGCCGGGCGCGGTGGCTCAGG + Intronic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
1171223264 20:23420684-23420706 GCCCGCGGGCGCGGTAGCTCGGG - Intronic
1172489224 20:35321286-35321308 GCGCGCGCGCGCGCACGCTCAGG + Intronic
1172529310 20:35619118-35619140 GCGCGGGGGCGCGGGGGCTGGGG - Intronic
1173649049 20:44651552-44651574 GTGAGCGCGCGCGGGGGCTCCGG - Intronic
1174467857 20:50731398-50731420 GCGCGCACGCGCCGCGGCTGTGG + Intergenic
1175831090 20:61965845-61965867 GCGCGAGTTCGCGGCGGGTCTGG - Intronic
1176159806 20:63642317-63642339 GCGCGCGTGAGCGGCAACCCCGG + Intronic
1176380733 21:6111105-6111127 GCGGCGGAGCGCGGCGGCTCCGG + Intergenic
1177010989 21:15730125-15730147 CCGCTCGTCCGCGGCGGCCCGGG - Exonic
1178992805 21:37368216-37368238 GCGAGTGTCCCCGGCGGCTCGGG + Intronic
1179512049 21:41879482-41879504 GGGCGCGCGCGGGGCGGGTCTGG + Exonic
1179742739 21:43427135-43427157 GCGGCGGAGCGCGGCGGCTCCGG - Intergenic
1180014763 21:45074803-45074825 GCGCGGGGCCGCGGCGGCTCGGG + Intronic
1180235808 21:46458866-46458888 GAGCGCGTGCGCGGCGGGAAGGG - Intergenic
1180951705 22:19723421-19723443 GCGCGCGTCCGCGCGGCCTCTGG + Exonic
1181126396 22:20704272-20704294 GGGCAGGTGGGCGGCGGCTCGGG - Intergenic
1181831609 22:25564784-25564806 GCGCGCGTGCGCGGGGCGCCGGG + Intergenic
1183444491 22:37844157-37844179 GGGCGAGTGCGCGGTGGCGCCGG - Exonic
1183683672 22:39349906-39349928 GCGCGCGCGGCCGGCGGCCCAGG - Intronic
1183692738 22:39400005-39400027 GCGTGTGTGCGCGGCGGGCCCGG + Intronic
1183856121 22:40636371-40636393 GCGCGCGTCCTCGGGGGGTCGGG - Intronic
1185258561 22:49849461-49849483 GAGCGCGGTCGCGGCGCCTCCGG + Intergenic
1185374260 22:50474870-50474892 GCGGGCGGGCTCCGCGGCTCGGG + Exonic
950710556 3:14810591-14810613 GAGCGCGGGGGCGGCGGCTGGGG - Intergenic
951803532 3:26623026-26623048 GCGTTGGTGCGCGGCGGCTGGGG - Exonic
953427155 3:42804562-42804584 GTGCGTGTGCGCGGCGGGTGGGG + Intergenic
953724765 3:45388446-45388468 GGGCGTCTGCGCGGCGGCCCGGG - Intergenic
954575189 3:51671833-51671855 GCTCACGTGCGCGGCGGCGGAGG - Exonic
956179087 3:66500933-66500955 GCGCGCGCGCGCGCAGCCTCGGG + Intronic
960639144 3:119810206-119810228 GCGCGCGGGCGGGCCGGCGCCGG + Intronic
963335713 3:143971974-143971996 GTGCGCGTGCGCGCGGGCACGGG + Exonic
966711918 3:182980423-182980445 GCGGGGGTGCGCGGCAGCGCCGG + Intronic
968433846 4:575257-575279 GCGCGGCCCCGCGGCGGCTCCGG - Intergenic
968498556 4:932428-932450 CAGCGCGTGCGCGGCGTCGCCGG + Exonic
968613886 4:1568778-1568800 GCGCGGGTGGGAGGCGGCGCGGG - Intergenic
968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG + Intronic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
973894235 4:55396159-55396181 GCGCCCGTGCGCGGCCGGCCCGG + Exonic
976733278 4:88284841-88284863 GCGCGCTTGCGCGGTGGGTGGGG + Intergenic
978619026 4:110621479-110621501 GAGGGTGCGCGCGGCGGCTCCGG + Intronic
982224483 4:153153368-153153390 GCGCGCGTGCGGCGGGGCTGCGG + Intronic
982616151 4:157637978-157638000 GCGCGGCTGCGCTGCGGCGCGGG - Intergenic
984966364 4:185143509-185143531 GGGCGCGGGCGCGGCGGGCCGGG + Intronic
992067403 5:73120508-73120530 CTGCGCGGGCGCGGCGGCCCGGG - Exonic
992373664 5:76170851-76170873 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
993905604 5:93620655-93620677 CCGCGCGGGCGCTGCGGGTCCGG - Exonic
998166671 5:139848284-139848306 GCGCGCGGCCGCGGCGGCGGCGG + Exonic
1000985194 5:167858621-167858643 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1001773418 5:174312027-174312049 GCGCGGGGGCGCGGGGGCTCGGG + Intergenic
1002341468 5:178519027-178519049 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1003645417 6:7910254-7910276 GGGCGCGGGCGCCGCGGCTCGGG - Intronic
1003995638 6:11537635-11537657 GTGAGCATGCGCAGCGGCTCCGG + Intergenic
1004605218 6:17188490-17188512 GCGGCCGGGCGCGGTGGCTCAGG + Intergenic
1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG + Intronic
1006472568 6:34236962-34236984 GCGTGAGTTCGCGGCCGCTCCGG + Exonic
1006787944 6:36680284-36680306 GCGCGCGTGCGTGTCTGCGCGGG + Intronic
1007363233 6:41373249-41373271 GGGAGCCGGCGCGGCGGCTCGGG - Intergenic
1007674483 6:43581777-43581799 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1009964789 6:70566907-70566929 TTGCGCCTGCGCGGAGGCTCGGG + Exonic
1013575730 6:111482672-111482694 GCGCGTGTGCGCGGCGGGGAGGG + Intronic
1014925585 6:127266849-127266871 GCGCGCGTTCCCGGCAGCTGCGG + Exonic
1015476483 6:133664081-133664103 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1016328223 6:142927001-142927023 GCGCGGCGGCGCGGCGGCGCGGG + Intronic
1018091132 6:160347908-160347930 GCGCGCGCGCGCCCCGGGTCCGG - Intergenic
1018728001 6:166627977-166627999 GCGCCCGAGGGCGGGGGCTCAGG + Intronic
1019689570 7:2403304-2403326 GACCGGGCGCGCGGCGGCTCGGG - Intergenic
1020281858 7:6653886-6653908 GCGCACGTGCGCGGCCACACGGG + Exonic
1022669521 7:32442794-32442816 GCGGCCGGGCGCGGTGGCTCAGG + Intergenic
1026471107 7:70694585-70694607 GCGCGCCGCGGCGGCGGCTCAGG + Intronic
1026665471 7:72336904-72336926 GCGCGCGTGGGGAGCGGCCCGGG - Intronic
1028712212 7:93922026-93922048 GCGCGGGTGGGCGGCGGGCCAGG + Exonic
1029483723 7:100827219-100827241 GCGCGCGCGGGCGGCGGGCCCGG + Exonic
1029496326 7:100896993-100897015 GTGCGCGCGCGCGGCGGTGCGGG + Intergenic
1029716964 7:102334163-102334185 GCGGCCGGGCGCGGTGGCTCAGG + Intergenic
1030048962 7:105521764-105521786 GCGCTCGGGCGCGGCGCCTCCGG + Intronic
1031982307 7:128135850-128135872 GCGCGCGAGCTCGGCGGCGGCGG + Intergenic
1032306101 7:130733744-130733766 GCGGACTTGCGCGGCAGCTCTGG - Exonic
1034446068 7:151114963-151114985 GCGCCGGTGGGCGGCGGCTCCGG - Intronic
1034963112 7:155374427-155374449 GCGCGTGTGGGCGGAGGCGCCGG + Intergenic
1034977797 7:155458242-155458264 GAGGGCGTGCGCGGCGGCCGCGG - Exonic
1035747551 8:1973489-1973511 CCGCGCGTGGGCGCGGGCTCGGG + Intergenic
1036147715 8:6270062-6270084 GCTGCCGGGCGCGGCGGCTCAGG + Intergenic
1037825302 8:22156823-22156845 GGGCGCGCGCGGGGCGGCGCGGG + Exonic
1039595454 8:38787133-38787155 GCGCGCGCGCGCGGGGGCGGCGG - Intronic
1040471254 8:47737618-47737640 GGGCTGCTGCGCGGCGGCTCCGG + Exonic
1042293982 8:67200309-67200331 GAGCTCTTGCACGGCGGCTCTGG + Intronic
1045277441 8:100721207-100721229 GCGCGGGTCCCCGCCGGCTCGGG + Intronic
1049552626 8:143267495-143267517 GCGGGCGGCGGCGGCGGCTCCGG + Intronic
1049844288 8:144792537-144792559 GTGCGCCTGCGCGGGGGCCCTGG - Exonic
1050151254 9:2621711-2621733 GGGCGGGAGCGCGGCGGCTTCGG - Intergenic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1053457017 9:38241342-38241364 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1054842663 9:69760020-69760042 GCGCGCGCGCGCGGGTGCTTCGG + Intergenic
1057208151 9:93185252-93185274 GCCGGCGTCCGCGGGGGCTCCGG - Exonic
1059210809 9:112513502-112513524 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1060064729 9:120494855-120494877 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1060643861 9:125261775-125261797 GCGCGCGTGCGCAGCGCCGCGGG - Intronic
1061859353 9:133460213-133460235 GAGCGCATGCGCGGCGGGGCCGG - Intronic
1062022578 9:134326391-134326413 GCGCGGGCGCGCGGCGGCGGGGG + Intronic
1185610574 X:1391872-1391894 GGACGCGGGCGCGGCCGCTCCGG - Intronic
1187067551 X:15855069-15855091 GCGCGGGCGCGCGGGCGCTCGGG - Intergenic
1187533522 X:20116854-20116876 GAGCGCGGCGGCGGCGGCTCCGG - Exonic
1187648324 X:21374143-21374165 GTGCGCGTGCGCGGCGGCGGAGG - Intergenic
1187915600 X:24149968-24149990 GCGCGCCTCCGCCGCCGCTCGGG - Intronic
1190114757 X:47619418-47619440 GAGCAGGTGGGCGGCGGCTCTGG - Exonic
1190285417 X:48957958-48957980 GCGCGCGTGCGCAGCGCCCCGGG - Intronic
1192847822 X:74924571-74924593 GCGTGTAAGCGCGGCGGCTCCGG + Intronic
1194133701 X:90112528-90112550 GCGTGGGTCGGCGGCGGCTCGGG + Intergenic
1196001985 X:110795955-110795977 AGGCGCGGGCGCGGCGGCCCGGG + Intergenic
1199699085 X:150363380-150363402 GCGGGCGGGCGCGGGGGCACCGG + Intronic
1199760121 X:150898711-150898733 GCGCGCGCGCGGCGCGGCCCCGG + Intronic
1200479484 Y:3682640-3682662 GCGTGGGTCGGCGGCGGCTCGGG + Intergenic