ID: 1134509276

View in Genome Browser
Species Human (GRCh38)
Location 16:14833706-14833728
Sequence GCGCGCGTGCGCGGCGGCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 2, 1: 0, 2: 1, 3: 25, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134509266_1134509276 28 Left 1134509266 16:14833655-14833677 CCGAGCATGCGCCTTAGTTCTCT 0: 3
1: 0
2: 0
3: 3
4: 77
Right 1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG 0: 2
1: 0
2: 1
3: 25
4: 225
1134509270_1134509276 17 Left 1134509270 16:14833666-14833688 CCTTAGTTCTCTCTTCTGGGGCT 0: 3
1: 0
2: 1
3: 17
4: 227
Right 1134509276 16:14833706-14833728 GCGCGCGTGCGCGGCGGCTCTGG 0: 2
1: 0
2: 1
3: 25
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134509276 Original CRISPR GCGCGCGTGCGCGGCGGCTC TGG Exonic