ID: 1134509883

View in Genome Browser
Species Human (GRCh38)
Location 16:14837486-14837508
Sequence CTGGGTTAACACTTCGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134509876_1134509883 26 Left 1134509876 16:14837437-14837459 CCAAGGCCACGCAACACGTGGAA No data
Right 1134509883 16:14837486-14837508 CTGGGTTAACACTTCGTGTCTGG No data
1134509877_1134509883 20 Left 1134509877 16:14837443-14837465 CCACGCAACACGTGGAAGACTCA No data
Right 1134509883 16:14837486-14837508 CTGGGTTAACACTTCGTGTCTGG No data
1134509875_1134509883 27 Left 1134509875 16:14837436-14837458 CCCAAGGCCACGCAACACGTGGA No data
Right 1134509883 16:14837486-14837508 CTGGGTTAACACTTCGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134509883 Original CRISPR CTGGGTTAACACTTCGTGTC TGG Intronic
No off target data available for this crispr