ID: 1134511046

View in Genome Browser
Species Human (GRCh38)
Location 16:14847048-14847070
Sequence TATCAAGTAGAGTCCCACGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134511040_1134511046 30 Left 1134511040 16:14846995-14847017 CCAGCCTGGACAACTTAGGGAGA 0: 3
1: 238
2: 3932
3: 25285
4: 113290
Right 1134511046 16:14847048-14847070 TATCAAGTAGAGTCCCACGGGGG No data
1134511041_1134511046 26 Left 1134511041 16:14846999-14847021 CCTGGACAACTTAGGGAGACTCA No data
Right 1134511046 16:14847048-14847070 TATCAAGTAGAGTCCCACGGGGG No data
1134511042_1134511046 -1 Left 1134511042 16:14847026-14847048 CCACAAATAATTTAAAAAATTAT No data
Right 1134511046 16:14847048-14847070 TATCAAGTAGAGTCCCACGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134511046 Original CRISPR TATCAAGTAGAGTCCCACGG GGG Intronic
No off target data available for this crispr