ID: 1134511437

View in Genome Browser
Species Human (GRCh38)
Location 16:14851258-14851280
Sequence CCGGTCACTAACACCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134511437_1134511441 -8 Left 1134511437 16:14851258-14851280 CCTCCTGGGGTGTTAGTGACCGG No data
Right 1134511441 16:14851273-14851295 GTGACCGGAAGCAAGTGTGAGGG No data
1134511437_1134511444 9 Left 1134511437 16:14851258-14851280 CCTCCTGGGGTGTTAGTGACCGG No data
Right 1134511444 16:14851290-14851312 TGAGGGCACTTCTGGCTTGCTGG No data
1134511437_1134511443 1 Left 1134511437 16:14851258-14851280 CCTCCTGGGGTGTTAGTGACCGG No data
Right 1134511443 16:14851282-14851304 AGCAAGTGTGAGGGCACTTCTGG No data
1134511437_1134511440 -9 Left 1134511437 16:14851258-14851280 CCTCCTGGGGTGTTAGTGACCGG No data
Right 1134511440 16:14851272-14851294 AGTGACCGGAAGCAAGTGTGAGG No data
1134511437_1134511446 24 Left 1134511437 16:14851258-14851280 CCTCCTGGGGTGTTAGTGACCGG No data
Right 1134511446 16:14851305-14851327 CTTGCTGGTGCTATTCTGTTGGG No data
1134511437_1134511445 23 Left 1134511437 16:14851258-14851280 CCTCCTGGGGTGTTAGTGACCGG No data
Right 1134511445 16:14851304-14851326 GCTTGCTGGTGCTATTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134511437 Original CRISPR CCGGTCACTAACACCCCAGG AGG (reversed) Intronic
No off target data available for this crispr