ID: 1134515920

View in Genome Browser
Species Human (GRCh38)
Location 16:14886841-14886863
Sequence CCCACTGCTCAGAGACGGCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 3, 2: 0, 3: 8, 4: 129}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134515909_1134515920 8 Left 1134515909 16:14886810-14886832 CCCTTGGCCAGTCCCTGTTCTTC 0: 4
1: 0
2: 0
3: 33
4: 268
Right 1134515920 16:14886841-14886863 CCCACTGCTCAGAGACGGCGAGG 0: 1
1: 3
2: 0
3: 8
4: 129
1134515911_1134515920 1 Left 1134515911 16:14886817-14886839 CCAGTCCCTGTTCTTCCATTTCC 0: 4
1: 1
2: 4
3: 57
4: 678
Right 1134515920 16:14886841-14886863 CCCACTGCTCAGAGACGGCGAGG 0: 1
1: 3
2: 0
3: 8
4: 129
1134515912_1134515920 -4 Left 1134515912 16:14886822-14886844 CCCTGTTCTTCCATTTCCCCCCA 0: 4
1: 0
2: 4
3: 65
4: 544
Right 1134515920 16:14886841-14886863 CCCACTGCTCAGAGACGGCGAGG 0: 1
1: 3
2: 0
3: 8
4: 129
1134515913_1134515920 -5 Left 1134515913 16:14886823-14886845 CCTGTTCTTCCATTTCCCCCCAC 0: 4
1: 0
2: 1
3: 53
4: 412
Right 1134515920 16:14886841-14886863 CCCACTGCTCAGAGACGGCGAGG 0: 1
1: 3
2: 0
3: 8
4: 129
1134515906_1134515920 24 Left 1134515906 16:14886794-14886816 CCAATCCAGACAGTTTCCCTTGG 0: 4
1: 0
2: 3
3: 14
4: 187
Right 1134515920 16:14886841-14886863 CCCACTGCTCAGAGACGGCGAGG 0: 1
1: 3
2: 0
3: 8
4: 129
1134515910_1134515920 7 Left 1134515910 16:14886811-14886833 CCTTGGCCAGTCCCTGTTCTTCC 0: 4
1: 0
2: 1
3: 33
4: 401
Right 1134515920 16:14886841-14886863 CCCACTGCTCAGAGACGGCGAGG 0: 1
1: 3
2: 0
3: 8
4: 129
1134515908_1134515920 19 Left 1134515908 16:14886799-14886821 CCAGACAGTTTCCCTTGGCCAGT 0: 4
1: 0
2: 2
3: 19
4: 270
Right 1134515920 16:14886841-14886863 CCCACTGCTCAGAGACGGCGAGG 0: 1
1: 3
2: 0
3: 8
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134515920 Original CRISPR CCCACTGCTCAGAGACGGCG AGG Exonic
900102470 1:967730-967752 CCCACTCCTCTGAGGCAGCGTGG - Intronic
900229930 1:1551575-1551597 CCCACTGGTCAGGGAGGGGGAGG + Intronic
900240687 1:1615963-1615985 CCGACTGCTCAGCGGCGGCCAGG - Intronic
902388267 1:16088407-16088429 ACCAAGGCTCAGAGAGGGCGTGG + Intergenic
902980421 1:20118702-20118724 CATACTGCTAAGAGATGGCGGGG + Intronic
903213032 1:21829205-21829227 CCCATGGCTCAGAGAGGGCTAGG + Intronic
903942536 1:26941696-26941718 CCCACTGCTCAGTGCCAGGGGGG - Intronic
904238892 1:29131357-29131379 CTCACTGCCCAGAGCCAGCGGGG + Intergenic
904360850 1:29970939-29970961 CCCACTCCAGAGAGAGGGCGAGG - Intergenic
906284691 1:44579283-44579305 CCTACTGCTCAGTGACTGTGTGG - Intronic
907073530 1:51558792-51558814 CCCACTGCCCAGAAAAGCCGGGG - Intergenic
908527520 1:65002272-65002294 CCCACTGCCCAGGGGCAGCGGGG - Intergenic
915102091 1:153507951-153507973 GGGACTGCTCAGAGAGGGCGGGG + Intergenic
917348873 1:174056627-174056649 CTCACTGCCCAGGGCCGGCGGGG + Intergenic
917654440 1:177112378-177112400 CCAGGTGCTCAGAGAAGGCGTGG - Intronic
920051838 1:203169017-203169039 CGCCTTGCTCAGAGAGGGCGCGG + Exonic
920150217 1:203900341-203900363 CTCAGTGCTCAGGGCCGGCGGGG - Intergenic
922306976 1:224352730-224352752 CTCACTGCCCAGGGCCGGCGGGG + Intergenic
923754490 1:236778382-236778404 CCCACTCCTCAGAGATTGCAAGG - Intergenic
1072863518 10:99032288-99032310 CCCACTGCTTAAAGAAGGGGTGG + Intronic
1074829873 10:117240992-117241014 CCTCCTGCGCAGCGACGGCGCGG + Intergenic
1075086922 10:119419837-119419859 CCCACGGCTCAGAGAAGGGAGGG - Intronic
1076634146 10:131871951-131871973 CCCACTGGTCTGAGACAGCAGGG - Intergenic
1076687762 10:132205799-132205821 CCGCCTGTGCAGAGACGGCGTGG - Intergenic
1076827548 10:132976937-132976959 CCCACTGGCCTGAGACGGGGAGG - Intergenic
1076889227 10:133275809-133275831 CACAGTGCTCAGAGACGCTGTGG + Intronic
1077583798 11:3435199-3435221 CTCACTGCCCAGGGACGGCGGGG + Intergenic
1079060971 11:17248531-17248553 CCCTCTGCTAAGAGAAGGTGTGG - Intronic
1084240700 11:67817871-67817893 CTCACTGCCCAGGGCCGGCGGGG + Intergenic
1086576658 11:88346496-88346518 CTCACTGATCAGATACGGGGTGG - Intergenic
1088693022 11:112344009-112344031 CCCACTGCCCAGAGAGGCTGAGG + Intergenic
1092534528 12:9375957-9375979 CCCAGTTCCCAGAGGCGGCGTGG - Intergenic
1097548023 12:61029123-61029145 CCCACTGCTCTCAGCAGGCGTGG + Intergenic
1102572252 12:113833994-113834016 CCCAGTGCTTTGAGACGCCGAGG - Intronic
1102895037 12:116592176-116592198 CCCACTGAGCAGAGGCGTCGAGG - Intergenic
1103342593 12:120229026-120229048 CCCACTGCTCCGAGGAGGAGGGG + Intronic
1104713272 12:131000113-131000135 AACACTGCTCAGTGACGGCAGGG - Intronic
1105034383 12:132908338-132908360 CGCACTGCGCAGAGACCACGCGG + Intronic
1109369252 13:61399951-61399973 CCCACTGCTCAGAAAAGGGCTGG - Intergenic
1114559631 14:23580702-23580724 CTCACTGCCCAGCGCCGGCGGGG - Intergenic
1116656949 14:47665636-47665658 CCCATTGCTCAGGGCCGGCAGGG - Intronic
1119773812 14:77236550-77236572 CCCACTGCACAGAGACCCCTGGG - Intronic
1119982636 14:79099300-79099322 CTCACTGCACAGAGAGGGAGAGG + Intronic
1123404779 15:20013111-20013133 CCCTCTACTCAGAGACAGTGGGG - Intergenic
1126581682 15:50247986-50248008 CCCAGTGCTCAGTGACAGCAAGG + Intronic
1127962700 15:63901622-63901644 ACCACTGCTGAGAGTCGGAGAGG + Intergenic
1129379136 15:75154501-75154523 CCCACTGCACAGAGAAGACTGGG - Intergenic
1132456896 16:29078-29100 CCCACTTCTCAGAGAGGTCAGGG + Intergenic
1132614324 16:832707-832729 CCTCCTGGACAGAGACGGCGAGG - Intergenic
1133121407 16:3611134-3611156 CCCACGGCTCACAGCAGGCGAGG + Intronic
1133352165 16:5108765-5108787 CTCACTGCCCAGGGCCGGCGGGG + Intergenic
1134515920 16:14886841-14886863 CCCACTGCTCAGAGACGGCGAGG + Exonic
1134703592 16:16285485-16285507 CCCACTGCTCAGAGATGGCGAGG + Exonic
1134963951 16:18426629-18426651 CCCACTGCTCAGAGATGGCGAGG - Exonic
1134968238 16:18509165-18509187 CCCACTGCTCAGAGATGGCGAGG - Intronic
1137639963 16:50020201-50020223 CCCACTACTCAGGGAGGCCGAGG + Intergenic
1138625782 16:58250207-58250229 CCCAGTGCTCAGTGAGGGCTTGG - Intronic
1139284211 16:65796348-65796370 CCCACTGCAGAGAGAAGGCTGGG - Intergenic
1139690376 16:68637954-68637976 CCCACTGCTTAGGGAGGCCGAGG + Intronic
1141759377 16:86017608-86017630 CCCAATGCTCTGAGAGGCCGAGG - Intergenic
1142222163 16:88860845-88860867 CCCTCTGCTCAGAGACGGGCCGG - Intronic
1143137355 17:4719331-4719353 CCCACTGCTCAGCGACAACCGGG + Exonic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151477745 17:74353414-74353436 CCCACTCAGCAGAGACAGCGGGG - Intronic
1151595704 17:75077053-75077075 CCCGCTGCTCAGACACAGCCTGG - Intergenic
1151680144 17:75618884-75618906 CTCACTGCCCAGAGACCCCGTGG - Intergenic
1160510861 18:79452579-79452601 CACTCTGCTCGGAGCCGGCGAGG - Intronic
1160872758 19:1284630-1284652 CCCACAGCTCTGAGACGTGGTGG - Intergenic
1161380331 19:3961447-3961469 CCCAGTGCTCAGTAACGCCGAGG + Intronic
1162691926 19:12440587-12440609 CTCACTGCACCGAGACGCCGAGG - Intronic
1163712435 19:18854772-18854794 CCCACTCCACAGTGACGGGGAGG - Intronic
1166706557 19:44911206-44911228 CTCAGTTCTCAGAGACGGGGAGG + Intergenic
929818659 2:45256698-45256720 CCCACTGCTCAGAGTCCACTTGG - Intergenic
935680838 2:105635769-105635791 GCCACTGCTCAGGGATGGCGAGG + Intergenic
937316569 2:120935476-120935498 CCCACAGCCCAGAGATGGGGAGG - Intronic
946163567 2:217850183-217850205 CCCACTGCTCTGAGCCAGCCCGG + Intronic
948499802 2:238383473-238383495 CCCACTGCACAGATACACCGTGG + Intronic
949050756 2:241896219-241896241 GCCACTGCTCAGGGACAGCTGGG - Intronic
1168871707 20:1134921-1134943 CCCAAATCTCAGAGACAGCGTGG + Intronic
1171427411 20:25057608-25057630 GCCACTGCTTAGAGCGGGCGGGG + Intronic
1172519391 20:35557259-35557281 CCCACAGCTCACAGACGCCCTGG - Intronic
1172777182 20:37414558-37414580 CCCATCCCTCAGAGACAGCGAGG - Intergenic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1179890032 21:44330754-44330776 CCCACTGCACAGAAACCGTGGGG - Exonic
1180261241 21:46670581-46670603 CCCACTGCTTGGAGCCGGAGAGG + Intergenic
1181107330 22:20582896-20582918 CCCAGAGCCCAGTGACGGCGCGG + Exonic
1181823318 22:25493137-25493159 CCAACTGCTCAGAGGCGGAGGGG + Intergenic
1182467187 22:30524833-30524855 CCCACTCCTCAGGAACGGCTGGG - Exonic
1184373419 22:44097107-44097129 CACACAGCTCAGAGATGGCATGG + Intronic
1184551831 22:45208822-45208844 ACCAAAGCTCAGAGACGGGGAGG - Intronic
1184893484 22:47393554-47393576 CCCACTGCACAGAGTGGCCGAGG + Intergenic
1184979424 22:48085464-48085486 CCCACTGCTCAGACACCACCAGG + Intergenic
1185299903 22:50074154-50074176 CACACTGCTCAGATCCTGCGTGG - Intronic
950785828 3:15434670-15434692 CTCACTGTTCAGAGATGGGGAGG + Intronic
951467850 3:23021048-23021070 CCCATTTCTAAGAGAAGGCGGGG + Intergenic
953932080 3:47010438-47010460 CCCGCTGCTCAGAGTAGGCTGGG + Intergenic
954628624 3:52036282-52036304 CCCCCAGCCCAGAGACTGCGGGG + Intergenic
958573109 3:95912352-95912374 CCCAGTGCTCAGAGGCAGCCCGG + Intergenic
962204305 3:133422564-133422586 TCCACTGCTCAGAGATGATGGGG - Intronic
962264484 3:133935397-133935419 CCTGCTGCTCAGAGACAGAGGGG - Intronic
962874868 3:139528173-139528195 CACATTGCTCAGAGAAAGCGTGG - Intronic
967876714 3:194272565-194272587 CCCACCGCTCAGAGGAAGCGAGG + Intergenic
980729962 4:136812212-136812234 CCCAGTGCTCAGTGGCGGCCTGG + Intergenic
983134940 4:164068503-164068525 CTCACTGCTCGGGGCCGGCGGGG - Intronic
985774413 5:1833419-1833441 CCCACAGCTCTGAGAAGGCCAGG - Intergenic
986457612 5:7935054-7935076 CCCACTGATCAGAGAAGCAGGGG - Intergenic
991952073 5:71955917-71955939 CCCCCAGCTCTGAGAGGGCGTGG - Intergenic
994407450 5:99363090-99363112 CCCTCTGCTCAGAGGCCTCGTGG - Intergenic
1001963748 5:175895913-175895935 CGAACTGCTCAGACAGGGCGAGG - Intergenic
1013507428 6:110814733-110814755 CCGAGTGCTCGGAGACGGCGGGG - Intronic
1014978673 6:127921048-127921070 CCCACTGCACAGAGATGGCCTGG + Intergenic
1015199734 6:130565752-130565774 CCCACTGTTCAGAGACATCAGGG + Intergenic
1015633365 6:135252898-135252920 ACCACTGCTCAGTGACAGCCTGG - Intergenic
1020220021 7:6229032-6229054 CCCTCTGCTCAGAGGGGGTGTGG - Intronic
1028303301 7:89228981-89229003 CTCACTGCCCAGTGCCGGCGGGG + Intronic
1029784401 7:102772936-102772958 CCCAGGGCTCAGAGAAGGTGAGG - Intronic
1031484466 7:122310798-122310820 CCCAAGGCTGAGAGATGGCGAGG + Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1035275970 7:157748144-157748166 CCTACAGCTCAGAGACGCAGGGG - Intronic
1035628234 8:1089581-1089603 CCCACTGCTCAGAGTTGGGTTGG + Intergenic
1039618362 8:38974689-38974711 CCCACTGCACAGGCACGGCCGGG - Exonic
1043310830 8:78857389-78857411 CCCACACCTGAGAGAAGGCGTGG - Intergenic
1044781173 8:95744828-95744850 CCCACTGGTAAGTGATGGCGTGG - Intergenic
1049546683 8:143235113-143235135 ACCACGGCTCAGAGAGGGCAGGG - Intergenic
1053817540 9:41928430-41928452 CTCACTCCCCAGAGAGGGCGGGG - Intronic
1054107796 9:61072102-61072124 CTCACTCCCCAGAGAGGGCGGGG - Intergenic
1054613061 9:67259023-67259045 CTCACTCCCCAGAGAGGGCGGGG + Intergenic
1056905693 9:90645780-90645802 CCCTCTGCTCAGACAGTGCGTGG + Intergenic
1057050405 9:91919446-91919468 TCCAGTGCTCGGAGACAGCGAGG - Intronic
1057564684 9:96157273-96157295 CCCACCTCTGAGAGACGGCCCGG + Intergenic
1057726907 9:97574325-97574347 CTCACTGCCCGGAGCCGGCGGGG - Intronic
1060101173 9:120842498-120842520 CTCACTGCTCAGAGGCAGCGAGG + Intronic
1061498628 9:130989969-130989991 CCCACTGCACAGAGTCGGACGGG + Intergenic
1061873998 9:133534969-133534991 CCCACTGCTCAGAGTGGGGCTGG + Intronic
1062567055 9:137168094-137168116 CCCACTGCTCAGAGACCCCAGGG - Exonic
1062737219 9:138144120-138144142 CCCTCTTCTCAGAGAGGCCGGGG - Intergenic
1186407101 X:9313728-9313750 CACACTGCTCAGAGAGGTGGTGG + Intergenic
1190649934 X:52559114-52559136 CACACTGCTTAGAGAGGGCAAGG - Intergenic
1200210466 X:154344769-154344791 CGCATTGCCCAGAGGCGGCGCGG - Intergenic
1200220386 X:154387323-154387345 CGCATTGCCCAGAGGCGGCGCGG + Intergenic
1200399464 X:156010645-156010667 CCCACTTCTCAGAGAGGTCAGGG - Intronic