ID: 1134518763

View in Genome Browser
Species Human (GRCh38)
Location 16:14908062-14908084
Sequence CTGGAGGCAGAGCTGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134518763_1134518769 -7 Left 1134518763 16:14908062-14908084 CCTGTCTCCAGCTCTGCCTCCAG No data
Right 1134518769 16:14908078-14908100 CCTCCAGGAAAGCCGGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134518763 Original CRISPR CTGGAGGCAGAGCTGGAGAC AGG (reversed) Intronic
No off target data available for this crispr