ID: 1134521350

View in Genome Browser
Species Human (GRCh38)
Location 16:14920448-14920470
Sequence GGCGAGACCCACAGTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134521350_1134521356 -10 Left 1134521350 16:14920448-14920470 CCCTGCCCACTGTGGGTCTCGCC No data
Right 1134521356 16:14920461-14920483 GGGTCTCGCCAAAAAACTTGGGG No data
1134521350_1134521360 22 Left 1134521350 16:14920448-14920470 CCCTGCCCACTGTGGGTCTCGCC No data
Right 1134521360 16:14920493-14920515 TTGCTTGTGCCCAGTGAAGATGG No data
1134521350_1134521361 26 Left 1134521350 16:14920448-14920470 CCCTGCCCACTGTGGGTCTCGCC No data
Right 1134521361 16:14920497-14920519 TTGTGCCCAGTGAAGATGGTTGG No data
1134521350_1134521357 -9 Left 1134521350 16:14920448-14920470 CCCTGCCCACTGTGGGTCTCGCC No data
Right 1134521357 16:14920462-14920484 GGTCTCGCCAAAAAACTTGGGGG No data
1134521350_1134521362 27 Left 1134521350 16:14920448-14920470 CCCTGCCCACTGTGGGTCTCGCC No data
Right 1134521362 16:14920498-14920520 TGTGCCCAGTGAAGATGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134521350 Original CRISPR GGCGAGACCCACAGTGGGCA GGG (reversed) Intronic
No off target data available for this crispr