ID: 1134521599

View in Genome Browser
Species Human (GRCh38)
Location 16:14921413-14921435
Sequence AGCCATTGGCGCAGGCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134521599_1134521610 3 Left 1134521599 16:14921413-14921435 CCCCCAGGCCTGCGCCAATGGCT No data
Right 1134521610 16:14921439-14921461 CGTCAGGGCCAGGGCTACTCGGG No data
1134521599_1134521607 -7 Left 1134521599 16:14921413-14921435 CCCCCAGGCCTGCGCCAATGGCT No data
Right 1134521607 16:14921429-14921451 AATGGCTGCACGTCAGGGCCAGG No data
1134521599_1134521612 21 Left 1134521599 16:14921413-14921435 CCCCCAGGCCTGCGCCAATGGCT No data
Right 1134521612 16:14921457-14921479 TCGGGTCCCCCTATGCGCTATGG No data
1134521599_1134521609 2 Left 1134521599 16:14921413-14921435 CCCCCAGGCCTGCGCCAATGGCT No data
Right 1134521609 16:14921438-14921460 ACGTCAGGGCCAGGGCTACTCGG No data
1134521599_1134521608 -6 Left 1134521599 16:14921413-14921435 CCCCCAGGCCTGCGCCAATGGCT No data
Right 1134521608 16:14921430-14921452 ATGGCTGCACGTCAGGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134521599 Original CRISPR AGCCATTGGCGCAGGCCTGG GGG (reversed) Intronic
No off target data available for this crispr