ID: 1134522498

View in Genome Browser
Species Human (GRCh38)
Location 16:14925030-14925052
Sequence GGGGCTTCTGCCGAGCGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134522480_1134522498 28 Left 1134522480 16:14924979-14925001 CCTTAAGGCTGGGCCGCAGGCGC No data
Right 1134522498 16:14925030-14925052 GGGGCTTCTGCCGAGCGGGTGGG No data
1134522484_1134522498 3 Left 1134522484 16:14925004-14925026 CCGTTCACCCCGGGCTCCTCAGG No data
Right 1134522498 16:14925030-14925052 GGGGCTTCTGCCGAGCGGGTGGG No data
1134522481_1134522498 15 Left 1134522481 16:14924992-14925014 CCGCAGGCGCAGCCGTTCACCCC No data
Right 1134522498 16:14925030-14925052 GGGGCTTCTGCCGAGCGGGTGGG No data
1134522493_1134522498 -6 Left 1134522493 16:14925013-14925035 CCGGGCTCCTCAGGCGGGGGGCT No data
Right 1134522498 16:14925030-14925052 GGGGCTTCTGCCGAGCGGGTGGG No data
1134522490_1134522498 -4 Left 1134522490 16:14925011-14925033 CCCCGGGCTCCTCAGGCGGGGGG 0: 6
1: 0
2: 3
3: 23
4: 192
Right 1134522498 16:14925030-14925052 GGGGCTTCTGCCGAGCGGGTGGG No data
1134522492_1134522498 -5 Left 1134522492 16:14925012-14925034 CCCGGGCTCCTCAGGCGGGGGGC No data
Right 1134522498 16:14925030-14925052 GGGGCTTCTGCCGAGCGGGTGGG No data
1134522479_1134522498 29 Left 1134522479 16:14924978-14925000 CCCTTAAGGCTGGGCCGCAGGCG No data
Right 1134522498 16:14925030-14925052 GGGGCTTCTGCCGAGCGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134522498 Original CRISPR GGGGCTTCTGCCGAGCGGGT GGG Intronic
No off target data available for this crispr