ID: 1134523772

View in Genome Browser
Species Human (GRCh38)
Location 16:14929776-14929798
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134523772_1134523779 -8 Left 1134523772 16:14929776-14929798 CCAGCCCCAGGCCTCCGTCGGTG No data
Right 1134523779 16:14929791-14929813 CGTCGGTGCTGTGGTCACCCTGG No data
1134523772_1134523782 10 Left 1134523772 16:14929776-14929798 CCAGCCCCAGGCCTCCGTCGGTG No data
Right 1134523782 16:14929809-14929831 CCTGGACAGCAGCAACCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134523772 Original CRISPR CACCGACGGAGGCCTGGGGC TGG (reversed) Intronic
No off target data available for this crispr